ID: 921904981

View in Genome Browser
Species Human (GRCh38)
Location 1:220486722-220486744
Sequence GCATCTAGTAGGTAGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921904981_921904989 29 Left 921904981 1:220486722-220486744 CCTGCTTTCTACCTACTAGATGC No data
Right 921904989 1:220486774-220486796 CACTTCCAAATATCTCCTGGAGG No data
921904981_921904988 26 Left 921904981 1:220486722-220486744 CCTGCTTTCTACCTACTAGATGC No data
Right 921904988 1:220486771-220486793 AGACACTTCCAAATATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921904981 Original CRISPR GCATCTAGTAGGTAGAAAGC AGG (reversed) Intergenic
No off target data available for this crispr