ID: 921908667

View in Genome Browser
Species Human (GRCh38)
Location 1:220524327-220524349
Sequence ACTTTGTTTTAGGTACTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921908667_921908669 -2 Left 921908667 1:220524327-220524349 CCTTGTAGTACCTAAAACAAAGT No data
Right 921908669 1:220524348-220524370 GTATGCAAATAATTATTGACTGG No data
921908667_921908670 18 Left 921908667 1:220524327-220524349 CCTTGTAGTACCTAAAACAAAGT No data
Right 921908670 1:220524368-220524390 TGGCCAAGTCTATCAGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921908667 Original CRISPR ACTTTGTTTTAGGTACTACA AGG (reversed) Intergenic
No off target data available for this crispr