ID: 921910383

View in Genome Browser
Species Human (GRCh38)
Location 1:220542541-220542563
Sequence GCTGGGAACCCCTACTGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921910375_921910383 22 Left 921910375 1:220542496-220542518 CCTAAATTGAGGATGCTTCCTTC 0: 1
1: 0
2: 1
3: 30
4: 185
Right 921910383 1:220542541-220542563 GCTGGGAACCCCTACTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 67
921910380_921910383 4 Left 921910380 1:220542514-220542536 CCTTCAGAAAGGGATTGGGTTGC 0: 1
1: 0
2: 1
3: 14
4: 117
Right 921910383 1:220542541-220542563 GCTGGGAACCCCTACTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921910383 Original CRISPR GCTGGGAACCCCTACTGACG TGG Intronic
905236920 1:36556321-36556343 TCTGGGCAACCCTACTGAAGTGG - Intergenic
907489225 1:54798321-54798343 CCTGGGAACTCCTGCTGAAGGGG + Intronic
913426604 1:118738211-118738233 GCTGGCAGCCCCTAGTGATGGGG + Intergenic
915194647 1:154180421-154180443 ACTTTGAACCCCTACTGAGGAGG - Intronic
915659310 1:157389050-157389072 GCTTGGAACCCCTACTGGCCAGG - Intergenic
916023824 1:160816814-160816836 GGTGGGAACTCCTGCTGACAGGG - Exonic
921910383 1:220542541-220542563 GCTGGGAACCCCTACTGACGTGG + Intronic
1067265172 10:44735537-44735559 GCTGGGGACCCCAACTGTAGTGG + Intergenic
1067460085 10:46451773-46451795 GCTGGGAAGTCCTACAGACTGGG + Intergenic
1067627105 10:47932840-47932862 GCTGGGAAGTCCTACAGACTGGG - Intergenic
1078581112 11:12540353-12540375 ACTAGGAACCCCTACTGCTGTGG - Intergenic
1078752714 11:14180129-14180151 CCTGGGAACCCCTGCTGTCCTGG - Intronic
1085408039 11:76275719-76275741 GCTGAGCATCCCTACTCACGGGG + Intergenic
1089221636 11:116876897-116876919 GCTGGGAACCGCTGCTGCAGGGG - Intronic
1090213258 11:124937997-124938019 GCTGGGACCACCTACTGCTGTGG + Intergenic
1092446464 12:8562166-8562188 GAGGGGAGCCCCTACTGAAGGGG + Intergenic
1096431242 12:51545048-51545070 GCTGGGGACCCCTGCTGTAGAGG - Intergenic
1101342650 12:103856851-103856873 GGTGGGAACCTACACTGACGGGG + Intergenic
1102295956 12:111736856-111736878 GCTGGGAATCCCTGCTGCAGAGG + Exonic
1107851113 13:44574589-44574611 GATGGGAGCCCCTACTGTGGTGG - Exonic
1123931033 15:25171749-25171771 GCTGGGAAGGCCCACTGTCGAGG + Intergenic
1133002188 16:2857174-2857196 GCTGGGGACCCCTCCTCACTGGG - Intronic
1133002212 16:2857246-2857268 GCTGGGGACCCCTCCTCACTGGG - Intronic
1133002229 16:2857294-2857316 GCTGGGGACCCCTCCTCACTGGG - Intronic
1139401425 16:66684865-66684887 GCAGGGAACCCCTGCTCAGGGGG - Intronic
1142232995 16:88908552-88908574 GCTGGGTGCCCCCACGGACGGGG - Intronic
1142239630 16:88939348-88939370 GCTGGGATCCTCTAGTGACAGGG - Intronic
1156457397 18:37302460-37302482 CCTGGGAGCCCCTTCTGATGAGG + Intronic
1156977723 18:43244712-43244734 GCAGGGAAACCATACTGAAGTGG + Intergenic
1158447215 18:57531948-57531970 GCTGAGAACGCCTTCTGATGGGG - Intergenic
1158674583 18:59506694-59506716 GCAGGGGAGCCCTACTGACATGG + Intronic
1161594636 19:5144800-5144822 GCTGGGACCCCCTTCCGAGGGGG + Exonic
1164259309 19:23555386-23555408 GAAGGGAACCCCTGCTGAAGGGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
926496370 2:13593013-13593035 GCTGGGAACCCCACGTGAGGTGG - Intergenic
937680642 2:124640699-124640721 TCTGGGAACCTTTACTGAGGGGG - Intronic
948012994 2:234664749-234664771 GCTGTGAACCCCTAATGATGTGG - Intergenic
948155270 2:235776526-235776548 GCTGTGAACCCCTCTTGTCGAGG + Intronic
1174899433 20:54483037-54483059 GCTGGAAAGCCCTTCTGACATGG - Intronic
1175109631 20:56638084-56638106 ACTGGGAACCCCTCCTGGCCTGG + Exonic
1175532646 20:59684714-59684736 GCTGGGAGCCCCTAGAGAGGAGG + Intronic
1175912876 20:62413085-62413107 GGCGGGAACCCCAACTGATGGGG - Intronic
1181600933 22:23951593-23951615 CCTGGGAACCCCCACTGGGGAGG + Intergenic
1182302644 22:29346322-29346344 GCTGGGAACCGCTGCTGTAGGGG - Intronic
1185346182 22:50311838-50311860 GCTGGGAGCCCTTGCTGATGTGG - Exonic
954294186 3:49665056-49665078 GCTGGGGACCCCTACTGTGTTGG - Intronic
959264023 3:104114885-104114907 GCTTGGAACCCTTACTGGAGAGG - Intergenic
963901697 3:150739096-150739118 GCTGGGAACCCCTAATCTCAAGG + Intergenic
969170264 4:5356569-5356591 GCAGGGAAGCCCTAGTGAAGGGG - Intronic
974227988 4:59073028-59073050 GCTGGGAACCCCTACTTTAGTGG + Intergenic
984692074 4:182738137-182738159 GCTGTGAACCCCTCATGAAGGGG + Intronic
990699404 5:58459706-58459728 ACTGGGAAGCGCTACTGCCGGGG - Exonic
990862501 5:60342510-60342532 GCTGGGAACAATAACTGACGTGG + Intronic
992116687 5:73545145-73545167 GCTGGGAACCCCTGCTCTAGCGG - Intergenic
998100215 5:139426649-139426671 ACTGGGAACCCGAACTGAGGGGG - Intronic
999203710 5:149833636-149833658 GCTGGGCAGCCCCACGGACGAGG + Exonic
1002582031 5:180214901-180214923 GCTGGGCACCCCTGCTGGCAGGG + Intergenic
1008511975 6:52284543-52284565 GCTCGGAGCCCCTGCGGACGCGG - Intronic
1009855582 6:69258718-69258740 GTTGGGAACCACTACTGTCTTGG - Intronic
1019410286 7:903810-903832 GCTGGCAGCCCCCACTGACAGGG + Intronic
1024258760 7:47558709-47558731 GCTGGGACCCTCTGCTGAGGGGG - Intronic
1046598015 8:116284194-116284216 GCAGAGAACCCCTGCTGAGGTGG - Intergenic
1048227918 8:132607444-132607466 GCTGGGAACATCCACTGACATGG + Intronic
1051528115 9:18070290-18070312 GCTGGGAAACCCATCTGACTTGG + Intergenic
1055172714 9:73279710-73279732 GCTGGGAAATCCTACAGAGGTGG - Intergenic
1057195441 9:93113734-93113756 GCTGGGAACCCCTAATGCTGGGG + Intergenic
1057828355 9:98388410-98388432 GCTGGGAATCACCACTGAAGGGG - Intronic
1061302503 9:129713560-129713582 GCTGCGAACCCCTCTTCACGGGG - Intronic
1062020459 9:134316937-134316959 GCTGGGAACCCCCGGTGATGAGG + Intergenic
1062523664 9:136969813-136969835 GCTGGGACCCCCTAGTAACGAGG - Intronic
1190261000 X:48796806-48796828 GTTGGGAACCCCTGCTGTAGAGG - Intergenic
1201438261 Y:13982333-13982355 GTTGGGAACCCATCCTGACTAGG - Intergenic
1201446320 Y:14059727-14059749 GTTGGGAACCCATCCTGACTAGG + Intergenic