ID: 921912526

View in Genome Browser
Species Human (GRCh38)
Location 1:220565630-220565652
Sequence TAGCCTGAGCTTTTGGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921912526_921912530 -10 Left 921912526 1:220565630-220565652 CCCTAGCCCAAAAGCTCAGGCTA 0: 1
1: 0
2: 0
3: 10
4: 123
Right 921912530 1:220565643-220565665 GCTCAGGCTAAAGACTCTGTAGG 0: 1
1: 0
2: 1
3: 11
4: 87
921912526_921912531 -7 Left 921912526 1:220565630-220565652 CCCTAGCCCAAAAGCTCAGGCTA 0: 1
1: 0
2: 0
3: 10
4: 123
Right 921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 91
921912526_921912532 0 Left 921912526 1:220565630-220565652 CCCTAGCCCAAAAGCTCAGGCTA 0: 1
1: 0
2: 0
3: 10
4: 123
Right 921912532 1:220565653-220565675 AAGACTCTGTAGGAGGAAACTGG 0: 1
1: 1
2: 3
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921912526 Original CRISPR TAGCCTGAGCTTTTGGGCTA GGG (reversed) Intronic
902292313 1:15443357-15443379 TAGCCTGAGCTTGTGGGGCCAGG + Intronic
904659464 1:32073541-32073563 TAGGCGGAGCTTCTGGGCTGAGG + Intronic
905010718 1:34745315-34745337 GTGCCTGAGCCCTTGGGCTATGG - Intronic
906074978 1:43045463-43045485 GACCCTGGGGTTTTGGGCTAAGG + Intergenic
906095323 1:43219369-43219391 TAACCTGAGCCTTTGGGAGAAGG - Intronic
916039224 1:160948114-160948136 TAGCCTCAGCTTTTGGCTTAGGG - Intronic
916985812 1:170190828-170190850 GAGGCTGAGCCTTTGGGCTGAGG - Intergenic
917604015 1:176606946-176606968 TAGTCTTAGATGTTGGGCTAAGG + Intronic
918673065 1:187245002-187245024 TACACTGAGCTTTAGGGCAATGG + Intergenic
919272304 1:195363528-195363550 TTGCCTGTGCTTCTGGGGTATGG - Intergenic
920740606 1:208577991-208578013 TACCCTGGGCTTTTTGCCTAGGG - Intergenic
921535558 1:216345071-216345093 CAGCCTGAACTTTTGCGCAATGG + Intronic
921912526 1:220565630-220565652 TAGCCTGAGCTTTTGGGCTAGGG - Intronic
921925265 1:220705890-220705912 TAGCCTGGGCTTTAGAGCGACGG + Intergenic
923113425 1:230911903-230911925 TACCCAGATCTTTTGGGGTAAGG - Intronic
923286744 1:232503375-232503397 TAGAAACAGCTTTTGGGCTAGGG - Intronic
1066621760 10:37362384-37362406 TAGCCAGAGCATTTAGGCAAGGG - Intronic
1068808511 10:61228030-61228052 CAGACTGACCTTTTGGGCTGTGG + Intergenic
1074614284 10:115050986-115051008 TGGCCTGAGCTTCTGGCCTAAGG - Intergenic
1075514918 10:123101012-123101034 AAGGCTGAGCTTTGGGGCTCTGG + Intergenic
1075757294 10:124823450-124823472 AAGCCTCAGGTTTTAGGCTAAGG + Intronic
1079171125 11:18096899-18096921 TTGCCTGAGCTTTAGGGTTTAGG - Intronic
1083263759 11:61536805-61536827 TGCCCTGGGCTTGTGGGCTAGGG - Intronic
1084912879 11:72405498-72405520 TAGACTGAGCTTTTATCCTAGGG - Intronic
1088572086 11:111232096-111232118 TGGCCTGAGCTTTTGCAATAAGG - Intergenic
1091532218 12:1370095-1370117 TGGCCTGAGCTTTTGACCTGAGG - Intronic
1092912698 12:13162015-13162037 GAGCCTGGGCTTTAGGGCCACGG - Intergenic
1096834773 12:54342807-54342829 TATCCAGCTCTTTTGGGCTAAGG - Intronic
1098304586 12:69089900-69089922 TATCCTGAGCATTTGGGGTTTGG + Intergenic
1098439015 12:70498860-70498882 TTGCCTGAACTTTTGAGCAATGG - Intergenic
1099044161 12:77695186-77695208 TTGCCTGTGCTTGTGGGGTATGG + Intergenic
1103342183 12:120226583-120226605 AAGCCTGGGCTTTTGGTTTATGG + Intronic
1103424427 12:120820085-120820107 TAGCCAGAGCTTATGGGTAAAGG - Intronic
1113911978 13:113846544-113846566 AAGCCTGAGTTTTTGGTGTACGG + Exonic
1115861715 14:37694063-37694085 TTGCCTGTGCTTATGGGGTATGG - Intronic
1115942456 14:38624382-38624404 TAGCCAGAGCAATTGGGCAAGGG + Intergenic
1115955225 14:38770666-38770688 TAGCCTGCACTCTTAGGCTATGG + Intergenic
1120160408 14:81139527-81139549 TAAGCTGAGCTTCTGGTCTAAGG - Intronic
1123827794 15:24101220-24101242 TAGGCTGAGCTCATGGGCTGGGG - Intergenic
1123857277 15:24426693-24426715 TAGGCTGAGCTCATGGGCTGGGG - Intergenic
1123861905 15:24477221-24477243 TAGGCTGAGCTCATGGGCTGGGG - Intergenic
1130025696 15:80268758-80268780 TAGCTTGAGCAATTGGGCAAGGG + Intergenic
1131155613 15:90073396-90073418 TAGCCTGGGCTTTGGGGGTTGGG + Intronic
1133873743 16:9713719-9713741 AAGCCTGAGCTGTTGGACAATGG - Intergenic
1139012621 16:62650902-62650924 TAGGATGAGCTTTAGAGCTAAGG - Intergenic
1139322472 16:66126663-66126685 TAGTTTGAGCTCATGGGCTAAGG - Intergenic
1139962040 16:70723714-70723736 TTGCCTGAGCTATGGGGCTGGGG + Intronic
1142329964 16:89445526-89445548 TAGCCTGAGCATTTGGAGGACGG - Intronic
1142710208 17:1718859-1718881 AAGCCTGTGCTTTTGACCTAGGG - Intronic
1143186706 17:5014350-5014372 CAGCCTCTGCTTTTGGGGTATGG + Intronic
1149534943 17:57425887-57425909 GAGCTTGAGCTTTTGGTCTTAGG + Intronic
1150056697 17:62023415-62023437 CATCCTGAGCTTCTGGGATATGG - Intronic
1151364482 17:73608271-73608293 TAGACTGAGCTTGTGGGTTTTGG + Intronic
1151806075 17:76406252-76406274 GTGCCTGGGCTTTTGGGCGATGG - Intronic
1203166866 17_GL000205v2_random:105491-105513 TAGCCTTAGCTTTTAGTCAACGG - Intergenic
1154165993 18:12014884-12014906 GACCCTGAGATTCTGGGCTAAGG - Intronic
1155642162 18:28031216-28031238 TAGCCTGAGCATTTGGGTGGAGG - Intronic
1164779646 19:30882165-30882187 GGGCCTGAGCCTGTGGGCTATGG - Intergenic
1165489236 19:36113864-36113886 TTGCCTGTTCTTTTGGGGTAAGG - Intronic
933136377 2:78741051-78741073 GAGACTGTTCTTTTGGGCTATGG - Intergenic
941925548 2:170890729-170890751 TTGCAAGAGCTTTTGAGCTATGG + Intergenic
943181890 2:184555033-184555055 AAGCCTGTGGTTTGGGGCTAGGG - Intergenic
946090180 2:217215538-217215560 CAGCCTGAGCTTCTGGGCTCAGG + Intergenic
1172489157 20:35320496-35320518 TAGCCTGAGCTGTGGGGCACAGG - Intronic
1174114304 20:48216346-48216368 AAGCCTGGGCTTTGGGGCTGTGG + Intergenic
1176196416 20:63838273-63838295 TAGACTGAGGTTTTGGGTTTGGG - Intergenic
1176404889 21:6353606-6353628 TAGCCTTAGCTTTTAGTCAACGG + Intergenic
1176432268 21:6635498-6635520 TAGCCTTAGCTTTTAGTCAACGG - Intergenic
1181760061 22:25052089-25052111 GGGCCTGTGCTTTTGGCCTATGG + Intronic
1182518409 22:30871778-30871800 TAGCCTGGGCTCTTGGCCTGCGG - Intronic
949956209 3:9270993-9271015 TTGCCTGGGCTTTTGGACTAAGG + Intronic
952778339 3:37068745-37068767 TGGGCTGAACTTTTGGGCAAGGG + Intronic
953248651 3:41222181-41222203 TGGCCTGAGCCTTTGGACTAAGG - Intronic
953566895 3:44040132-44040154 TAGTCTGACCTTCTGGCCTAGGG + Intergenic
953955061 3:47225557-47225579 TAGCCTGAGCAATTAGGCTAAGG + Intergenic
956421402 3:69089878-69089900 TGGCCTGATCATTTGGCCTATGG + Intronic
972439059 4:39067309-39067331 TAGACTGAGGTTATGGGCTTTGG + Intronic
974180388 4:58377247-58377269 TATTCTGAGGTTTTGGGGTACGG + Intergenic
974361805 4:60890494-60890516 AAGCCTCAGCTTTTCAGCTATGG + Intergenic
978032847 4:103957208-103957230 TTGCCTGTGTTTGTGGGCTATGG - Intergenic
978215230 4:106193002-106193024 TAGTCTGAGCTTTGAAGCTATGG - Intronic
979594467 4:122519046-122519068 TTGCCTGTGCTTGTGGGTTATGG + Intergenic
984394548 4:179178628-179178650 TAGCCAGAGCACTTGGGCTAGGG - Intergenic
986857500 5:11887873-11887895 TAGACTGAGGTTATGGGCTTTGG + Intronic
987292679 5:16523452-16523474 TAGGCTGAGATTTTGGGTTGGGG + Intronic
990172817 5:53073595-53073617 TAGCCTGAGCTTTGCAACTATGG + Intronic
992478975 5:77131353-77131375 AAGCCTGAGCCATTGGGCTTGGG - Intergenic
996415597 5:123206938-123206960 AAGCCTCAGCATTTGGGGTAGGG + Intergenic
996571139 5:124933350-124933372 TTGCCTCAGCTTTTGAGCTGAGG - Intergenic
997394215 5:133544928-133544950 TACTCTGAGCTTTTGGGCAGTGG + Intronic
998876251 5:146602820-146602842 TGCCCTCAGCTTTTGGGCTTCGG + Intronic
999959346 5:156737199-156737221 TAGACTGAGTTTTAGGGCTCTGG - Intronic
1004027140 6:11830340-11830362 TTGCATGAGCTGTTGGGGTAGGG - Intergenic
1005423004 6:25672425-25672447 TAGCAGGAGCATTTGGGGTAGGG + Intronic
1006311189 6:33261684-33261706 TTGCCTGTGCTTGTGGGGTATGG - Intronic
1007414743 6:41684814-41684836 CAGCCTGAGCTTTGGGGGCAGGG - Exonic
1007840873 6:44714944-44714966 GAGCCTGGGCATTTGGGCAAAGG + Intergenic
1008404055 6:51099427-51099449 TTGCCTGGGGTGTTGGGCTAGGG - Intergenic
1009886308 6:69628130-69628152 TATCATGGGCTTTTGGTCTAGGG - Intergenic
1013283655 6:108662216-108662238 TAGACTGAGGTTATGGGCTTTGG + Intronic
1014120388 6:117718882-117718904 AAGCCTGAGCTATTAGGATAGGG - Intergenic
1015200165 6:130570698-130570720 CAGCTTGAGATTTTGGGCTGAGG - Intergenic
1021499278 7:21311879-21311901 TAGCCTGAGTTTTTGAGGGAAGG - Intergenic
1021742644 7:23703275-23703297 TAGGCTTTGCTTTTGGGCAAGGG + Intergenic
1024464482 7:49697331-49697353 TTGCCTGAGCTTTTGGGATCAGG + Intergenic
1026902377 7:74044360-74044382 TAGCCTGAGCTTTGGAGTTTGGG - Intronic
1027126970 7:75563353-75563375 CAGCCTGTGCCTTTGGGCTGGGG - Intronic
1028743480 7:94302136-94302158 AAGTCTGAGTTTTTGGGCTTGGG - Intergenic
1036992130 8:13609889-13609911 TAGACTGTTCTTTTGGGATAAGG + Intergenic
1037797455 8:22008438-22008460 TAGCCAGAAATCTTGGGCTAGGG - Intergenic
1039255370 8:35712723-35712745 TAGCATGCTCTTTTAGGCTATGG + Intronic
1041183112 8:55269723-55269745 CAGTCTGAGCTTTTGGGCAGCGG - Intronic
1041360674 8:57050185-57050207 GAGCCTGAGATTTTGGTCAAAGG - Intergenic
1041905043 8:63023299-63023321 CATCCTGAGCTTTGGGGCTAAGG - Intronic
1043027514 8:75089059-75089081 TAGCCTCAGCTTTTGGCAGAAGG + Intergenic
1044645141 8:94433049-94433071 AAGCCTGAGGTCTAGGGCTAAGG - Intronic
1045349721 8:101328018-101328040 CAGTTTGAGCTTTTGGGCTCTGG + Intergenic
1045363087 8:101450748-101450770 TATCCTGAGCCTTTTGGCTGGGG + Intergenic
1045913513 8:107438647-107438669 TAACCTGATATTTTAGGCTATGG + Intronic
1053025146 9:34723337-34723359 TAGCCGGAGCTTATCGTCTAGGG + Exonic
1056443401 9:86641997-86642019 TGGCTTAAGCTTTTGGGCTCTGG + Intergenic
1057517563 9:95735038-95735060 TAGGCTTAGACTTTGGGCTACGG - Intergenic
1058477920 9:105359046-105359068 TAGTCTGAGCTTTTGTACTCGGG + Intronic
1059067618 9:111102208-111102230 GAGGCTGGACTTTTGGGCTAAGG + Intergenic
1060715046 9:125918139-125918161 TGGCCTGAGTTTTTTGGCTGAGG + Intronic
1061099565 9:128482431-128482453 AAACATGAGCTTTTAGGCTATGG + Intronic
1061270534 9:129538459-129538481 TAGCCTTAGCATTTGATCTATGG - Intergenic
1203439270 Un_GL000195v1:173214-173236 TAGCCTTAGCTTTTAGTCAACGG + Intergenic
1186741535 X:12523327-12523349 TAGCCTGAGGTTTGGTGCTCAGG + Intronic
1188850422 X:35125395-35125417 TAGCCTGAATTTTTAGGCTCTGG - Intergenic
1189222134 X:39381639-39381661 CAGCCTCAGCTTTTGAGCTGAGG + Intergenic
1191201611 X:57788756-57788778 TTGCCTGTGCTTCTGGGATATGG - Intergenic
1193980112 X:88172011-88172033 AAGCCTCAGCTTTTGGGCCAAGG + Intergenic
1194099633 X:89687895-89687917 TACCCTGAACTTTTTAGCTACGG - Intergenic