ID: 921912527

View in Genome Browser
Species Human (GRCh38)
Location 1:220565631-220565653
Sequence TTAGCCTGAGCTTTTGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921912527_921912532 -1 Left 921912527 1:220565631-220565653 CCTAGCCCAAAAGCTCAGGCTAA No data
Right 921912532 1:220565653-220565675 AAGACTCTGTAGGAGGAAACTGG 0: 1
1: 1
2: 3
3: 14
4: 221
921912527_921912531 -8 Left 921912527 1:220565631-220565653 CCTAGCCCAAAAGCTCAGGCTAA No data
Right 921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921912527 Original CRISPR TTAGCCTGAGCTTTTGGGCT AGG (reversed) Intronic
No off target data available for this crispr