ID: 921912531

View in Genome Browser
Species Human (GRCh38)
Location 1:220565646-220565668
Sequence CAGGCTAAAGACTCTGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921912527_921912531 -8 Left 921912527 1:220565631-220565653 CCTAGCCCAAAAGCTCAGGCTAA No data
Right 921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 91
921912526_921912531 -7 Left 921912526 1:220565630-220565652 CCCTAGCCCAAAAGCTCAGGCTA 0: 1
1: 0
2: 0
3: 10
4: 123
Right 921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921912531 Original CRISPR CAGGCTAAAGACTCTGTAGG AGG Intronic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
904348980 1:29892751-29892773 AAGGATAAAGTCTTTGTAGGTGG - Intergenic
909933090 1:81520620-81520642 CAGGCAAGAGAGTCTGAAGGAGG - Intronic
910026688 1:82663208-82663230 CAGGCTAAATACAGTGCAGGTGG - Intergenic
912283885 1:108347568-108347590 CTGGCTAAACACGCAGTAGGAGG + Intergenic
915569626 1:156737460-156737482 CTGTCTAAAGACACTGCAGGAGG - Exonic
916036945 1:160930772-160930794 CTGTCCAAAGACTCTGCAGGAGG + Intergenic
919422327 1:197385478-197385500 GAGGAGAAAGACTCTGGAGGAGG - Intronic
919659979 1:200234791-200234813 CAACCTAAAGACTCTACAGGTGG + Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923373037 1:233331394-233331416 CAGGATAAAGACCATGTATGAGG - Intronic
1063276402 10:4573264-4573286 CAGCCAAAAAACTCTCTAGGTGG - Intergenic
1063872262 10:10430927-10430949 GATGCTAAAGACCCTGTGGGTGG + Intergenic
1073291040 10:102413453-102413475 CAGGCTAAAGACTCTGCCAAGGG + Intronic
1077907518 11:6545793-6545815 TAGTCTTAAGACTCTGTAGGGGG - Exonic
1083922543 11:65788363-65788385 CAGACCAAAGACTTTGTTGGGGG - Intronic
1096200887 12:49681965-49681987 CAGGAGAAAGACCCTGTAAGTGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096850253 12:54430900-54430922 TAGGGGAAAGGCTCTGTAGGGGG + Intergenic
1097387049 12:58962490-58962512 CAGGCTAAAAACTATCTAGTGGG + Intergenic
1098420950 12:70297334-70297356 CAGACTACAAACTCTGTAGCTGG + Intronic
1101859201 12:108468792-108468814 CAGGATAAAGACTCTACATGGGG + Intergenic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1106186075 13:27411037-27411059 CAGGATAAGGGCTCTGTAGCAGG + Intergenic
1107003929 13:35585270-35585292 CAGGCTAAAGACTGAATGGGAGG - Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1124037968 15:26073836-26073858 AAGGCTGACGACTGTGTAGGTGG + Intergenic
1133158806 16:3895388-3895410 CAACCTGAAGACTCTGGAGGAGG - Intergenic
1144382690 17:14718438-14718460 CAGGCTAAAGTCACTGGAGATGG + Intergenic
1145134487 17:20389320-20389342 CAGGATAAAGTCACTGTAAGTGG - Intergenic
1151643033 17:75410387-75410409 CAGGCTGCAGACTCTGTGGAGGG - Intergenic
1153268889 18:3298738-3298760 AAGGCTAAAGACACTTTGGGAGG - Intergenic
1153656521 18:7287643-7287665 CAGGCTTAAGGGTCTGGAGGAGG - Intergenic
1158342644 18:56483462-56483484 CAGGCTCAAGCCTCTGGAGTGGG - Intergenic
1162596527 19:11633762-11633784 CCCAGTAAAGACTCTGTAGGGGG - Intergenic
1162923842 19:13919711-13919733 AAGGCCCAAGACTCTATAGGTGG + Intronic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
925571718 2:5319386-5319408 CAGGTTACATGCTCTGTAGGGGG - Intergenic
928919655 2:36513481-36513503 CAGGCTACAGAGTCTGTACATGG - Intronic
932214574 2:69958574-69958596 GAGGGTAAAGAGTCTGTAAGTGG - Intergenic
942212879 2:173689168-173689190 CATGCAAAAGACTCTGTACCTGG - Intergenic
944659559 2:201910077-201910099 CAGCCCAAAGACACTGTAGCTGG + Intergenic
1175708582 20:61201359-61201381 CAGACTACAGTCTCTCTAGGTGG - Intergenic
1181842066 22:25671686-25671708 CTGGCTGTAGAGTCTGTAGGAGG + Intronic
1184590200 22:45476910-45476932 CAGGCCTTAGCCTCTGTAGGCGG - Intergenic
1184724385 22:46335256-46335278 CAGACTTAAGACTGTCTAGGCGG - Intronic
952911446 3:38191569-38191591 CAGGTTAAATATTTTGTAGGAGG + Intronic
957281860 3:78161258-78161280 CAGGCTGAAGATTTTGGAGGAGG - Intergenic
961829476 3:129616082-129616104 CAGGCTGATGGCTCTGAAGGGGG + Intergenic
972084731 4:35201419-35201441 CAGGCAGAAGACTCTGTCAGAGG - Intergenic
984103152 4:175511776-175511798 GAGGCAAATGACTCTGTAGAGGG - Intergenic
985108529 4:186522916-186522938 CAGGAAAAAGACTGGGTAGGTGG + Intronic
985151184 4:186948597-186948619 CAGTCTACAGACTGTGTTGGTGG + Intergenic
985221128 4:187706518-187706540 CAGTGCAAAAACTCTGTAGGAGG + Intergenic
988893651 5:35648295-35648317 CAGATAAAAGCCTCTGTAGGTGG - Intronic
993526149 5:88968130-88968152 CAGGCAAAAGACTCTATATCTGG - Intergenic
995742151 5:115366245-115366267 TAGGCTACAGGCTCTGTGGGAGG - Intergenic
996411096 5:123160105-123160127 CATGCAAATGACTATGTAGGAGG - Intronic
996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG + Intergenic
999147506 5:149406055-149406077 AACACTAAAGAATCTGTAGGAGG + Intergenic
999491805 5:152058482-152058504 CAGGCTGAAGATACTGTAGCTGG + Intergenic
1000230837 5:159313796-159313818 CAGATGAAAGACCCTGTAGGGGG + Intergenic
1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG + Intergenic
1004797526 6:19104007-19104029 CTGGCTAGAGATTCTGGAGGAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1014766209 6:125409598-125409620 CAGGCAAGAGACACTGTACGGGG - Intergenic
1016396978 6:143634700-143634722 CAGGCTGATGACTTTGTAGTTGG + Intronic
1016890039 6:148996554-148996576 CAAGAGAAAGAGTCTGTAGGAGG - Intronic
1017711290 6:157170605-157170627 ATGGCTCCAGACTCTGTAGGTGG + Intronic
1018069870 6:160154851-160154873 CAGCCTGAAGACTATGAAGGGGG - Exonic
1021312953 7:19116077-19116099 CAGTCTAGAGACTCTGGAGCTGG - Exonic
1021601276 7:22366211-22366233 GAGGCTAAAGACGCTGGATGTGG + Intergenic
1022670087 7:32447394-32447416 GAGGGGAAAGACTCTGTGGGAGG + Intergenic
1023633260 7:42184113-42184135 CATGCTAAGCACTCTCTAGGAGG + Intronic
1024239576 7:47423960-47423982 CATGCCAAAGACTGTGAAGGTGG - Intronic
1024668087 7:51565584-51565606 CCAGCTAAAGGCTCTGTAAGAGG - Intergenic
1026295365 7:69047494-69047516 CAGGCTAAGGCCTCCCTAGGGGG + Intergenic
1028719222 7:94010632-94010654 CAGGGTAAATATTCTGTGGGTGG - Intergenic
1029646154 7:101857240-101857262 CAGGCAAAATGCCCTGTAGGAGG - Intronic
1029800439 7:102941312-102941334 CAGGGTAAAGAATCTGGAAGTGG + Intronic
1033024083 7:137755752-137755774 GAGGCTAAACAAACTGTAGGAGG + Intronic
1036730117 8:11255548-11255570 CAAACGAAAAACTCTGTAGGTGG + Intergenic
1038334303 8:26634130-26634152 CAGGCTAGAAACTCTGAGGGCGG - Intronic
1045485693 8:102629194-102629216 CAGGTTAATCACTCTGAAGGGGG - Intergenic
1055719365 9:79154439-79154461 CAGGCTGTAGACTGTGGAGGAGG - Intergenic
1057534162 9:95882373-95882395 AAAGCTAAAGACCCTGTAGCAGG - Intronic
1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG + Intergenic
1060509476 9:124221664-124221686 TAGGATAAAAACTCTGTAAGTGG - Intergenic
1060743843 9:126117017-126117039 CAGGCTTAAGACTCTGCATTAGG + Intergenic
1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG + Intergenic
1185483930 X:468183-468205 CAGGCTGGAGGCTCTGAAGGAGG - Intergenic
1191594400 X:62926335-62926357 AAAACTAAAGATTCTGTAGGTGG + Intergenic
1192765644 X:74137322-74137344 GAGGCTAAAGAGTCTATGGGTGG - Intergenic
1194959947 X:100223780-100223802 CAGGCTGCAGAGGCTGTAGGAGG - Intergenic
1198733509 X:139760322-139760344 CAGGCCAAACACTGTGGAGGAGG - Intronic
1201063521 Y:10069010-10069032 CAGGATAGAGTCTCTGCAGGAGG - Intergenic