ID: 921913306

View in Genome Browser
Species Human (GRCh38)
Location 1:220576479-220576501
Sequence TTTCCAGGACCCTCCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921913306_921913311 7 Left 921913306 1:220576479-220576501 CCTCAGTGGGAGGGTCCTGGAAA 0: 1
1: 0
2: 0
3: 17
4: 280
Right 921913311 1:220576509-220576531 TGGCAAAGGGTGTGAAAATTTGG 0: 1
1: 0
2: 1
3: 22
4: 263
921913306_921913310 -6 Left 921913306 1:220576479-220576501 CCTCAGTGGGAGGGTCCTGGAAA 0: 1
1: 0
2: 0
3: 17
4: 280
Right 921913310 1:220576496-220576518 TGGAAAAGTTACATGGCAAAGGG 0: 1
1: 1
2: 5
3: 69
4: 484
921913306_921913309 -7 Left 921913306 1:220576479-220576501 CCTCAGTGGGAGGGTCCTGGAAA 0: 1
1: 0
2: 0
3: 17
4: 280
Right 921913309 1:220576495-220576517 CTGGAAAAGTTACATGGCAAAGG 0: 1
1: 0
2: 4
3: 27
4: 268
921913306_921913312 8 Left 921913306 1:220576479-220576501 CCTCAGTGGGAGGGTCCTGGAAA 0: 1
1: 0
2: 0
3: 17
4: 280
Right 921913312 1:220576510-220576532 GGCAAAGGGTGTGAAAATTTGGG 0: 1
1: 0
2: 2
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921913306 Original CRISPR TTTCCAGGACCCTCCCACTG AGG (reversed) Intronic
900329961 1:2129122-2129144 TGTCCAGGCCCCTTACACTGAGG + Intronic
904180025 1:28659711-28659733 TCTTCTGGACCCTCCCAGTGGGG + Intergenic
904894470 1:33803871-33803893 CTTCCAGGCTCATCCCACTGAGG + Intronic
905065278 1:35175743-35175765 ATTCCAAGACCCCCCCACAGTGG + Intergenic
907531416 1:55101688-55101710 TTTCCAGTACCTTCCCCCAGTGG - Exonic
908088623 1:60663010-60663032 TTTCCAGGAAGCTCAAACTGAGG - Intergenic
908478917 1:64517753-64517775 TGTCCAGGTCCCTCCTCCTGAGG - Intronic
909108320 1:71441344-71441366 TTTTAAGGGCCCTCCCACTGGGG + Intronic
909663659 1:78110627-78110649 TTTCCAAGTCCCTCCCACCTAGG - Intronic
915440273 1:155941541-155941563 TTTCCACACCCCTCCCTCTGAGG + Intergenic
917799025 1:178553355-178553377 TTTCCAGAGCCCTCCCATTTAGG + Intergenic
919854960 1:201698923-201698945 TTTCTGGGGCCCTGCCACTGAGG - Intronic
919995969 1:202750714-202750736 TTTCCAAGAGCCTACCACAGTGG - Exonic
921059899 1:211577538-211577560 TTTCCAGCACCCAACTACTGGGG + Intronic
921913306 1:220576479-220576501 TTTCCAGGACCCTCCCACTGAGG - Intronic
924571380 1:245240763-245240785 CTTCCAGCTCCCTCCCACAGCGG - Intronic
1065681763 10:28242592-28242614 TCTCCAGGACCCTTCCAGAGGGG + Intronic
1067157554 10:43794741-43794763 TTGCCAGGGCCCTCACACTGGGG + Intergenic
1068595556 10:58899527-58899549 TGTTCAGGAACCTCTCACTGAGG + Intergenic
1069532626 10:69230390-69230412 TTTCCCAGCCCCTCCCCCTGGGG + Intronic
1070160800 10:73865711-73865733 GAGCCAGGGCCCTCCCACTGTGG - Intronic
1073481260 10:103787518-103787540 TTCCCTCCACCCTCCCACTGGGG + Intronic
1075547866 10:123368970-123368992 TGGCCAGGCCCCTCTCACTGCGG - Intergenic
1076844902 10:133065318-133065340 TTACAAGGACCCTCTCCCTGTGG - Intergenic
1078925353 11:15869907-15869929 TAGCCATGACCCTTCCACTGTGG - Intergenic
1079420338 11:20280370-20280392 TTTCCATGATCCACCAACTGAGG - Intergenic
1083301562 11:61742341-61742363 TTTCTAGGACCTTCCCACACAGG + Intronic
1083367611 11:62150893-62150915 ATTCCAGGCCCTTCCCTCTGGGG - Intronic
1085249702 11:75134899-75134921 CTTCAGGGACCCTCCCACAGAGG - Intronic
1085451279 11:76635452-76635474 TTCCCAGAACCCTCCTTCTGTGG - Intergenic
1088932488 11:114366178-114366200 TTTCTAGGAAAGTCCCACTGTGG - Intergenic
1089333354 11:117705543-117705565 ATTCCAGGCCACTCCCACAGTGG - Intronic
1090435709 11:126684844-126684866 TTCCCAGGTCCCTCCCGCTGTGG - Intronic
1090768279 11:129895659-129895681 GCTCCAGGACCCGCCCGCTGTGG - Intergenic
1090903431 11:131052816-131052838 ATTCCAGGAACCTCACCCTGAGG + Intergenic
1091340623 11:134809954-134809976 GTTCCAGTGGCCTCCCACTGAGG - Intergenic
1091553444 12:1554167-1554189 CTTCCAGGAACCTCCCACATGGG - Intronic
1098015830 12:66103667-66103689 TTCACAGCGCCCTCCCACTGTGG + Intergenic
1101314439 12:103616331-103616353 TTTCCCTGACCCTGCCTCTGAGG - Intronic
1101723906 12:107374046-107374068 ATTCCAGAACCCTCCCACCATGG - Intronic
1103184486 12:118944558-118944580 TGTCCTGGAGCCTCCCACAGTGG - Intergenic
1104502214 12:129297174-129297196 TTTCCAGCCCCCTGCTACTGTGG - Intronic
1107134958 13:36933668-36933690 TTTGCAGGATGCTACCACTGGGG - Intergenic
1108725356 13:53174907-53174929 TGTACACGACGCTCCCACTGTGG - Intergenic
1114278512 14:21169356-21169378 TTTCCAGCCACCCCCCACTGGGG + Intergenic
1116429662 14:44831196-44831218 TTGCTAGTGCCCTCCCACTGTGG + Intergenic
1116867016 14:50039595-50039617 TTTCCAGGACTCTCCCTGAGAGG + Intergenic
1117825959 14:59703938-59703960 TTTCCAGGAGCTTCAAACTGTGG - Intronic
1118361299 14:65059653-65059675 TATTCAGGATTCTCCCACTGTGG - Intronic
1118468915 14:66056825-66056847 TTTCCCAGACCCTTCCTCTGGGG - Intergenic
1118723517 14:68610300-68610322 TTTTCAGATCCCTCCCACTCCGG + Intronic
1121788482 14:96680859-96680881 TTTCCAGGCCACACCCTCTGGGG - Intergenic
1202838130 14_GL000009v2_random:93952-93974 ATTCCAGAACCCTCCTGCTGAGG + Intergenic
1202907608 14_GL000194v1_random:84922-84944 TTTCCAGAACACTCCTTCTGAGG + Intergenic
1202885564 14_KI270722v1_random:103782-103804 ATTCCAGAACCCTCCTGCTGGGG - Intergenic
1202886051 14_KI270722v1_random:108190-108212 ATTCCAGAACACTCCTACTGTGG - Intergenic
1202886387 14_KI270722v1_random:111335-111357 TTTCCAGGACACTGCTGCTGTGG - Intergenic
1202886399 14_KI270722v1_random:111431-111453 ATTCCAGAACACTCCCGCTGTGG - Intergenic
1202886447 14_KI270722v1_random:111957-111979 ATTCCAGGACACTCCTGCTGTGG - Intergenic
1202886754 14_KI270722v1_random:114756-114778 TTTCCAGAACACTCCTGCTGTGG - Intergenic
1202887075 14_KI270722v1_random:117873-117895 ATTCCAGAACACTCCTACTGTGG - Intergenic
1202887212 14_KI270722v1_random:119019-119041 TTTCCAGAACACTCCTGCTGTGG - Intergenic
1123877660 15:24639912-24639934 TTTCCAGGTTCATCTCACTGGGG - Intergenic
1124553056 15:30700010-30700032 TCTCCAGGAACTTCCCAGTGAGG + Intronic
1124678187 15:31705660-31705682 TCTCCAGGAACTTCCCAGTGAGG - Intronic
1125887560 15:43240052-43240074 TTTCCATGACCTTCCCACCTTGG - Intronic
1128303265 15:66580768-66580790 TTTCCATCACCCTGCCACTGTGG + Intergenic
1128563209 15:68682138-68682160 TTTGGAGGACTCTCCCTCTGTGG - Intronic
1128673837 15:69594654-69594676 TTTACAGGAGCGTCCCACGGAGG + Intergenic
1130575851 15:85092682-85092704 ATTCCATGTCCCTCTCACTGAGG + Intronic
1131776988 15:95813638-95813660 ATTCCAGAAACCTCCCACAGTGG + Intergenic
1133876281 16:9737828-9737850 TTGCCAGCACACTCACACTGAGG + Intergenic
1134060624 16:11197569-11197591 TCTCCAGGCTCCTTCCACTGTGG - Intergenic
1135134404 16:19876949-19876971 TTTCCATGAACCACTCACTGTGG - Intronic
1137365650 16:47857187-47857209 TATCCAGGACCCAACCTCTGTGG - Intergenic
1137550023 16:49431183-49431205 TTACCAGCACCCTCCCATGGCGG + Intergenic
1138309528 16:56011609-56011631 TTTCCAGGTCCTCCCCACTGGGG + Intergenic
1139713023 16:68790908-68790930 TTTCCAGGCCTCTCCCAGAGAGG - Intronic
1140388365 16:74562785-74562807 TTTTCATGACCCACCCACTGAGG + Intronic
1142106620 16:88307144-88307166 TTTCAAGGTCCCCCACACTGGGG + Intergenic
1142702822 17:1674500-1674522 TTTCCAGGACATAGCCACTGAGG - Exonic
1142714923 17:1742155-1742177 TTTCCAGAACCCTCGCTCTTGGG + Intergenic
1142843253 17:2650567-2650589 CTCCCAGGATCCTCCCACTGAGG - Intronic
1143115106 17:4577567-4577589 TTTCCAGGATCCTCCCCCTTGGG - Intergenic
1143316156 17:6035041-6035063 TCTCCAGCCCCCTACCACTGTGG + Intronic
1144470267 17:15533690-15533712 TTCCCAGCACCCTCATACTGAGG - Intronic
1144836392 17:18158664-18158686 AGCCCAGCACCCTCCCACTGTGG - Intronic
1144841091 17:18186347-18186369 TTTCCAGGACACACCCTCTCCGG + Intronic
1144847435 17:18227211-18227233 CTGCCAGGACCCTCACACGGTGG + Intronic
1144926075 17:18809990-18810012 TTCCCAGCACCCTCATACTGAGG + Intergenic
1147331882 17:39704220-39704242 TCTCCAGGACCCTGCCCCTCAGG - Intronic
1147887265 17:43692505-43692527 TTCCCAGGCCCCTCCTACGGAGG + Intergenic
1150430363 17:65110765-65110787 TTTCCAGGACCCTCTGGCTTTGG - Intergenic
1150462282 17:65362688-65362710 TATCCAGCATCCTTCCACTGGGG - Intergenic
1150812864 17:68370375-68370397 TTTCGCTGACCCTCCCACTCTGG - Intronic
1151328812 17:73394806-73394828 TTTCCTCGACCCCTCCACTGTGG + Intronic
1151512641 17:74570682-74570704 CTTCCAGACCCCTCCCTCTGGGG + Intergenic
1152096007 17:78271952-78271974 TCTGCAGGTGCCTCCCACTGTGG - Intergenic
1152611272 17:81316018-81316040 TGTCCCAGACCCTCACACTGGGG + Intronic
1203157285 17_GL000205v2_random:16375-16397 ATTCCAGAACCCTCCTGCTGTGG - Intergenic
1203157671 17_GL000205v2_random:19876-19898 ATTCCAGGACACTCCTGCTGTGG - Intergenic
1203158025 17_GL000205v2_random:22947-22969 TTTCCAGAACACTCCTGCTGTGG - Intergenic
1156378174 18:36532997-36533019 TTACAAAGCCCCTCCCACTGTGG - Intronic
1157871231 18:51231894-51231916 TATTCTGGACCCTCCCACTTGGG + Intergenic
1158912128 18:62075163-62075185 TTTACAAGATCTTCCCACTGGGG - Intronic
1159051253 18:63422849-63422871 TTTCCAAGACCCGCCGACTGGGG + Intergenic
1159537621 18:69735493-69735515 TTCCAAGGCCCCTCCCAGTGGGG + Intronic
1160280241 18:77483319-77483341 TTTCCGGGAGCCTGCCCCTGTGG + Intergenic
1160329732 18:77980239-77980261 TCCCCAGGAGCCTCTCACTGAGG - Intergenic
1163675131 19:18651928-18651950 TTTCCCATTCCCTCCCACTGAGG - Intronic
1165267985 19:34677627-34677649 TTCCCAGAATCCTCCCCCTGCGG - Intronic
1166222861 19:41376786-41376808 TTGCCCGGACCCTGCCACCGAGG - Exonic
1168654511 19:58117788-58117810 CTTCCTCTACCCTCCCACTGGGG - Intronic
1202651004 1_KI270707v1_random:3509-3531 ATTCCAGAACCCTCCAGCTGGGG + Intergenic
1202660964 1_KI270708v1_random:70808-70830 ATTCCAGAACCCTCCTGCTGGGG - Intergenic
1202661435 1_KI270708v1_random:75022-75044 ATTCCAGAACACTCCTACTGTGG - Intergenic
1202661656 1_KI270708v1_random:77063-77085 ATTCCAGGACACTCCTGCTGTGG - Intergenic
1202661868 1_KI270708v1_random:78925-78947 ATTCCAGAACACTCCCGCTGTGG - Intergenic
1202661917 1_KI270708v1_random:79451-79473 ATTCCAGGACACTCCTGCTGTGG - Intergenic
1202662171 1_KI270708v1_random:81654-81676 TTTCCAGAACACTCCTGCTGTGG - Intergenic
1202662499 1_KI270708v1_random:84818-84840 ATTCCAGAACACTCCTACTGTGG - Intergenic
1202662640 1_KI270708v1_random:86008-86030 TTTCCAGAACACTCCTGCTGTGG - Intergenic
925181354 2:1819013-1819035 AGACCAGGTCCCTCCCACTGGGG + Intronic
928206880 2:29290817-29290839 TCTCCAGGTGCCTCCCACTCCGG - Intronic
929541903 2:42829155-42829177 TTTCCAGGCCCTTCCCATTCAGG - Intergenic
932935820 2:76099678-76099700 TTACCAGGTCCCTCCCACAATGG + Intergenic
933776271 2:85773128-85773150 TCTCCCAGACCCTCCCTCTGAGG - Intronic
934809350 2:97267071-97267093 TCTCCAGGTCCCACCCAGTGAGG + Intergenic
934828100 2:97489881-97489903 TCTCCAGGTCCCACCCAGTGAGG - Intergenic
935429232 2:102956990-102957012 TTTCCACCAGCCTTCCACTGTGG - Intergenic
935605501 2:104968991-104969013 TTTCCAAAACCCTGGCACTGGGG + Intergenic
936646524 2:114378336-114378358 TCTTCTGGACCCTCCCAGTGTGG + Intergenic
937018337 2:118627655-118627677 TTTCCACAACCCTCCCACACAGG - Intergenic
938088258 2:128416056-128416078 TCTCCTGGACCCTCCCATGGGGG + Intergenic
938162191 2:128995967-128995989 TTCCCATGACTCTGCCACTGGGG + Intergenic
940460775 2:153959962-153959984 CATGCAGGCCCCTCCCACTGTGG - Intronic
940987368 2:160062645-160062667 TTTCCTCGCCCCACCCACTGCGG + Intergenic
941111342 2:161421617-161421639 TATCCAGGTCCCACCCACTTGGG - Intronic
941958447 2:171229135-171229157 TTTCCAGGACCTGCCCAGTGAGG + Intronic
942272810 2:174294119-174294141 ATTCCAGTACTCTCCCACTATGG + Intergenic
942987667 2:182162057-182162079 TCTTCTGGACCCTCCCAGTGTGG - Intronic
943306076 2:186264323-186264345 TCTTCTGGACCCTCCCAGTGTGG - Intergenic
943829748 2:192445531-192445553 TCCCCAGGATCCTTCCACTGAGG + Intergenic
944410293 2:199434756-199434778 TTTCCAGAACCCCCTCCCTGTGG + Intronic
945498107 2:210534465-210534487 TTTCTAGGATTGTCCCACTGTGG + Intronic
946625021 2:221602176-221602198 TTCCTAAGACCCTCCCACAGAGG + Intergenic
947814058 2:233024111-233024133 ATTCCAGAACCCAACCACTGGGG - Intergenic
948264537 2:236627332-236627354 AATCCAGGACTCACCCACTGTGG - Intergenic
1169089359 20:2848775-2848797 TTTCCAGCACCCACCATCTGTGG - Intronic
1170343727 20:15358899-15358921 CCTCCAGTACTCTCCCACTGGGG + Intronic
1170612815 20:17928584-17928606 TGTCCCTGGCCCTCCCACTGGGG - Intergenic
1171235033 20:23517803-23517825 TTACCAGGCCCCTTCCCCTGTGG + Intergenic
1172012965 20:31857112-31857134 TCTCCAGGTGCTTCCCACTGTGG + Intronic
1172205547 20:33160447-33160469 TTCCCAGGAGCCTCCCATAGTGG - Intergenic
1172631107 20:36378794-36378816 TTCCCCGAACCCTCCTACTGTGG - Intronic
1173996887 20:47345441-47345463 TTTCCAGTACCCTTCCACTCAGG - Intronic
1174522850 20:51145103-51145125 TTACCAGGGCCCTCCTTCTGTGG - Intergenic
1175976516 20:62712982-62713004 GTCCCAGGCCCCTGCCACTGTGG - Intronic
1176204179 20:63879192-63879214 TTTCCAGGGCCATCCCAGTTTGG + Intronic
1176601121 21:8795986-8796008 ATTCCAGAACCCTCCAGCTGGGG - Intergenic
1177193037 21:17872792-17872814 TTTTCTGGACCCTCCTAGTGTGG + Intergenic
1178446379 21:32647302-32647324 TTTCCTGAACCCACTCACTGAGG + Intronic
1179601674 21:42482039-42482061 TGTCTAGAACCCTCCCACTCAGG + Intronic
1180328447 22:11454356-11454378 ATTCCAGAACCCTCCTGCTGGGG - Intergenic
1180328991 22:11459244-11459266 TTTCCAGAACACTCCTGCTGTGG - Intergenic
1180329312 22:11462361-11462383 ATTCCAGAACACTCCTACTGTGG - Intergenic
1180329451 22:11463555-11463577 TTTCCAGAACACTCCTGCTGTGG - Intergenic
1180343407 22:11687523-11687545 ATTCCAGAACCCTCCACCTGGGG - Intergenic
1180997248 22:19971689-19971711 TTTGCAGCTCCCACCCACTGGGG - Intronic
1182043531 22:27257027-27257049 TCTCCAGCCACCTCCCACTGTGG - Intergenic
1182430654 22:30297086-30297108 ATGCTAGGACACTCCCACTGAGG - Intronic
1183403524 22:37618629-37618651 TTCCAGGGAGCCTCCCACTGGGG + Intronic
1183713025 22:39517548-39517570 TTTACAGAACCCTCCCACCTCGG - Exonic
1184032116 22:41901193-41901215 TCTCCCGGTCCCTCCCACTCTGG - Intronic
1185281678 22:49972411-49972433 TCTCCTGGACCCTCCCACCTGGG + Intergenic
949952572 3:9241424-9241446 CTTCCAGGCCCCTCCCAGTCTGG - Intronic
950509771 3:13419429-13419451 TTTCCATCACCCTCCCTCTCGGG - Intronic
950670456 3:14522482-14522504 TGGCCAGGAATCTCCCACTGGGG + Intronic
951753378 3:26061734-26061756 TACCCAGGGACCTCCCACTGAGG + Intergenic
951988335 3:28646503-28646525 TTTCCTGGACTCTCCTACTTTGG + Intergenic
953921396 3:46954388-46954410 TTTACAGGGGCCACCCACTGAGG - Intronic
955961056 3:64341753-64341775 TTTCCAGGGCCCGCCCCCAGAGG + Intronic
956210367 3:66795831-66795853 GTTCCAGTTCCCTCCCACTGTGG - Intergenic
956793690 3:72699911-72699933 TATCCAGGCAGCTCCCACTGTGG + Intergenic
957092985 3:75750420-75750442 ATTCCAGAACACTCCTACTGTGG + Intronic
957093054 3:75750946-75750968 ATTCCAGAACACTCCTACTGTGG + Intronic
957093060 3:75750994-75751016 ATTCCAGAACACTCCTACTGTGG + Intronic
958036261 3:88173405-88173427 TTTTCCAGACCCTCCCAGTGTGG - Intergenic
965392040 3:168116701-168116723 TTTCCATGACCCTACCAGTAGGG - Intergenic
967443219 3:189533424-189533446 TTTCCAGGGCCCTTCCACAGAGG + Intergenic
968274563 3:197430082-197430104 TATCTAAGACTCTCCCACTGTGG + Intergenic
968445778 4:651358-651380 TTTCCAGGAGGCCCCCCCTGAGG - Intronic
968511496 4:997721-997743 TCTCAAGGCCCCTCCCAATGGGG + Intronic
968844173 4:3030704-3030726 TTGCCAGCAGCCTGCCACTGTGG - Intronic
969216259 4:5724639-5724661 TTCCAAGGACCCTGCCACAGAGG - Intronic
969396610 4:6925691-6925713 TTCCCAGGTTCCTCCCACTGAGG - Intronic
969662936 4:8540905-8540927 TTCCCAGGGCCTCCCCACTGCGG + Intergenic
970369534 4:15393364-15393386 TCTGCAGGACTCTTCCACTGTGG + Intronic
970797886 4:19936118-19936140 GCTCCAGGACCTTCACACTGCGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
973396179 4:49595004-49595026 ATTCCAGAACCCTCCTGCTGGGG + Intergenic
973396499 4:49597817-49597839 ATTCCAGAACCCTCCTGCTGGGG + Intergenic
976572877 4:86633502-86633524 TTTCCACATCCCTCCCACTTTGG + Intronic
977337620 4:95718389-95718411 TTTTCTGGACCCTCCCTGTGTGG + Intergenic
979936246 4:126699914-126699936 TTTGTAGCACCATCCCACTGTGG - Intergenic
980957518 4:139444389-139444411 TTTCCTGGACCCTCCCAGCTGGG - Intergenic
984958363 4:185069007-185069029 TTTACAGGAGCCTGCCTCTGGGG - Intergenic
1202761892 4_GL000008v2_random:119867-119889 ATTCCAGAACCCTCCTGCTGGGG - Intergenic
985804577 5:2032781-2032803 TATTCAGGAGCCTCACACTGTGG + Intergenic
985932585 5:3070228-3070250 TTTACAGCATGCTCCCACTGGGG - Intergenic
987055882 5:14191066-14191088 GTCCCATGTCCCTCCCACTGAGG - Intronic
992320839 5:75611773-75611795 TCTCCAAGACCCTCCCGCTTCGG - Exonic
996945923 5:129067377-129067399 TTTCCATCTCCCTCCCACTTTGG - Intergenic
998229305 5:140349558-140349580 CTTCCAGGTCCTCCCCACTGGGG - Intergenic
998767706 5:145506672-145506694 TTTGCAGTATCCTCCCATTGTGG - Intronic
999387467 5:151164766-151164788 TTCCCAGGCCCCTTCCTCTGTGG + Intergenic
999782124 5:154858173-154858195 TTTCCAGGCCGCGCCCACGGCGG + Intronic
1002192918 5:177488169-177488191 CTTCCAGGACCTTCCCACACTGG + Exonic
1002344987 5:178542545-178542567 TTTCCAGCACTCTCTCACTCTGG - Intronic
1003634446 6:7819580-7819602 TTACCAGGACCTTCCCAGTGAGG - Intronic
1005815875 6:29552445-29552467 CGTCCATGCCCCTCCCACTGAGG - Intergenic
1006993166 6:38232942-38232964 TTTCCAGAATCCACCCACTGAGG + Intronic
1006996988 6:38270458-38270480 TTCTCAGGATCCTCCCACTCTGG + Intronic
1007369557 6:41417374-41417396 TCTCCAGGACCCTCAGACAGAGG + Intergenic
1014851014 6:126340015-126340037 TTCCCGGGACCCGCCCACCGTGG + Intergenic
1015724198 6:136283765-136283787 TATCCATGGCCCTCCAACTGGGG + Intronic
1016615491 6:146043008-146043030 TTTCCAGGGGCCACCCACAGTGG + Intronic
1019736877 7:2654727-2654749 TTCACAGGACCATCCCTCTGTGG + Intronic
1020751518 7:12147215-12147237 TTCTCTGGACCCTCCCAATGTGG + Intergenic
1020860013 7:13480387-13480409 TTTCAAGAACCCTCCCATCGTGG + Intergenic
1021401910 7:20219321-20219343 TTTCCAGGACCATGGGACTGAGG - Intergenic
1021899526 7:25269813-25269835 TCTTCAGGACCCACTCACTGAGG - Intergenic
1023745112 7:43315826-43315848 CTCCCAGGATTCTCCCACTGTGG - Intronic
1026377882 7:69770451-69770473 TAGCCAGGATGCTCCCACTGCGG - Intronic
1026875212 7:73875451-73875473 CTTGGAGGACCCACCCACTGTGG + Intergenic
1027123261 7:75537443-75537465 TCTCCAGGGCCCCCCAACTGTGG - Exonic
1029282124 7:99442291-99442313 ATTCCAGCACACTCCGACTGTGG + Intronic
1029629782 7:101743194-101743216 CTTGCAGGACCCTTCCAGTGGGG - Intergenic
1030194036 7:106835736-106835758 TCTACAGGACCCTCCCTCTTGGG + Intergenic
1035518398 8:255939-255961 AGTGCAGGCCCCTCCCACTGCGG - Intergenic
1036570390 8:9975236-9975258 TTTCCAGGAACCTCACACCAGGG - Intergenic
1042515940 8:69659098-69659120 TTTCCAGGACCACCATACTGGGG - Exonic
1043257751 8:78157375-78157397 TCTTCAGGACCCTCCCAGTTGGG - Intergenic
1044523645 8:93227261-93227283 TTTACAGGATCATACCACTGGGG - Intergenic
1044693454 8:94900460-94900482 TTTTAAGGGCCCTCCCTCTGAGG - Intronic
1045397092 8:101772012-101772034 TTCCCAGGTCCCTACCACTCAGG - Intronic
1046137289 8:110044793-110044815 TTTCCAGGAACCCCCTTCTGTGG - Intergenic
1049019152 8:139941913-139941935 TCTGCAGGACCCTCCCCATGGGG - Intronic
1049482670 8:142834438-142834460 GTTCCTGGACCCTCCCTCTAGGG - Intronic
1050307090 9:4315744-4315766 CTTCCAGGAACCTCCCTCTTGGG - Intronic
1050619470 9:7437516-7437538 TTTCCAGGACCTTGCCTCTTTGG + Intergenic
1052271973 9:26636584-26636606 TTTCCATGACCCTCTTTCTGTGG - Intergenic
1052685082 9:31745360-31745382 TTTGCAGTACCCTCCTACTCAGG + Intergenic
1053467429 9:38319127-38319149 TTTCCAGGGCCCTGCCTTTGTGG - Intergenic
1054075352 9:60523759-60523781 TTTCCAGAACACTGCTACTGGGG - Intergenic
1055648954 9:78388377-78388399 TCTTCTGGACCCTCCCAGTGTGG - Intergenic
1057310804 9:93941901-93941923 TTTCCAGGACCCTTCAGCTGGGG - Intergenic
1058747755 9:108008331-108008353 TTTCCAGGACCATCTCATGGAGG + Intergenic
1060189584 9:121583565-121583587 TGCCCAGGACCCTGCCTCTGGGG - Intronic
1060553165 9:124495205-124495227 TCTCCGGGACCCTCCCAGTCAGG - Intronic
1062067006 9:134533983-134534005 TTCCCAGGGCCCTCCCTGTGAGG + Intergenic
1062174802 9:135155438-135155460 CTTCCAGGAGCCCCCCACAGTGG + Intergenic
1203484834 Un_GL000224v1:42995-43017 TTTCCAGAACACTCCTGCTGTGG - Intergenic
1203485187 Un_GL000224v1:46922-46944 ATTCCAGAACCCTCCTGCTGTGG - Intergenic
1203493035 Un_GL000224v1:124738-124760 ACTCCAGGACACTCCTACTGTGG + Intergenic
1203493698 Un_GL000224v1:130793-130815 TTTCCAGAACACTCCTGCTGTGG + Intergenic
1203494679 Un_GL000224v1:139953-139975 ATTCCAGAACCCTCCTTCTGTGG + Intergenic
1203495236 Un_GL000224v1:145080-145102 ATTCCAGAACCCTCCTGCTGTGG + Intergenic
1203495353 Un_GL000224v1:146134-146156 ATTCCAGAACACTCCTACTGTGG + Intergenic
1203495966 Un_GL000224v1:151854-151876 ATTCCAGAACACTCCTACTGTGG - Intergenic
1203495994 Un_GL000224v1:152046-152068 ATTCCAGAACCATCCTACTGTGG - Intergenic
1203496285 Un_GL000224v1:154582-154604 ATTCCAGAACACTCCCGCTGTGG - Intergenic
1203496495 Un_GL000224v1:156446-156468 ATTCCAGAACACTCCTACTGTGG - Intergenic
1203496598 Un_GL000224v1:157448-157470 TTTCCAGAACACTCCTCCTGTGG - Intergenic
1203497200 Un_GL000224v1:163201-163223 ATTCCAGAACCCTCCGGCTGTGG - Intergenic
1203497914 Un_GL000224v1:170100-170122 ATTCCAGAACCCTCCTGCTGTGG - Intergenic
1203505656 Un_KI270741v1:66609-66631 ACTCCAGGACACTCCTACTGTGG + Intergenic
1203506319 Un_KI270741v1:72668-72690 TTTCCAGAACACTCCTGCTGTGG + Intergenic
1203507297 Un_KI270741v1:81828-81850 ATTCCAGAACCCTCCTTCTGTGG + Intergenic
1203507979 Un_KI270741v1:88057-88079 ATTCCAGAACACTCCTACTGTGG + Intergenic
1203508590 Un_KI270741v1:93777-93799 ATTCCAGAACACTCCTACTGTGG - Intergenic
1203508617 Un_KI270741v1:93969-93991 ATTCCAGAACCATCCTACTGTGG - Intergenic
1203508907 Un_KI270741v1:96504-96526 ATTCCAGAACACTCCCGCTGTGG - Intergenic
1203509119 Un_KI270741v1:98368-98390 ATTCCAGAACACTCCTACTGTGG - Intergenic
1203509222 Un_KI270741v1:99370-99392 TTTCCAGAACACTCCTCCTGTGG - Intergenic
1203509759 Un_KI270741v1:105257-105279 ATTCCAGAACCCTCCGGCTGTGG - Intergenic
1203510466 Un_KI270741v1:112350-112372 ATTCCAGAACCCTCCTGCTGTGG - Intergenic
1203542660 Un_KI270743v1:104748-104770 ATTCCAGAACCCTCCTGCTGGGG - Intergenic
1186860495 X:13667849-13667871 TTTCCCTGACCCTCCCACACTGG - Intronic
1187227343 X:17386293-17386315 TTTCCAGGCCATTCCCACTCTGG + Intronic
1191643942 X:63458403-63458425 TTTCCATGATCCTCCAACTAAGG - Intergenic
1192399321 X:70818504-70818526 ATTCCAGAAGCCTTCCACTGAGG + Intronic
1193356021 X:80521188-80521210 TTTCCAGGGCAGTGCCACTGGGG + Intergenic
1196528758 X:116759035-116759057 TTTGCAGGACCTCCCAACTGGGG + Intergenic
1196746112 X:119073010-119073032 ATCCCAGGAGCCTCCCGCTGAGG - Intergenic
1201163365 Y:11184075-11184097 ATTCCAGAACCCTCCTGCTGGGG + Intergenic
1201769930 Y:17609952-17609974 CTTCCCTGGCCCTCCCACTGTGG + Intergenic
1201831624 Y:18296035-18296057 CTTCCCTGGCCCTCCCACTGTGG - Intergenic