ID: 921914550

View in Genome Browser
Species Human (GRCh38)
Location 1:220592752-220592774
Sequence TCTCAACTGCTTGGAGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921914548_921914550 -6 Left 921914548 1:220592735-220592757 CCTCTGGTAAGCATGATTCTCAA 0: 1
1: 0
2: 1
3: 10
4: 230
Right 921914550 1:220592752-220592774 TCTCAACTGCTTGGAGTGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 140
921914547_921914550 3 Left 921914547 1:220592726-220592748 CCTAGATAACCTCTGGTAAGCAT No data
Right 921914550 1:220592752-220592774 TCTCAACTGCTTGGAGTGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921914550 Original CRISPR TCTCAACTGCTTGGAGTGTA AGG Intronic
901585217 1:10284567-10284589 TCCCAGCTGCTTGGAGGGTGAGG + Intronic
903317351 1:22518726-22518748 TGTAAACTGCTTGGAGGGAAAGG - Intronic
904603120 1:31684361-31684383 TCTCCTCTGCTAGGAGTGTCAGG - Intronic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
907562794 1:55406300-55406322 TCTATTCTGCCTGGAGTGTAAGG - Intergenic
907962889 1:59299061-59299083 TCTCAACTCCTGGGAGTCTTCGG - Intronic
908043139 1:60137433-60137455 TTTAACCTGCTTGGAGTTTATGG + Intergenic
909398675 1:75199771-75199793 TCGCAATTGCTTGGAATGAAAGG - Intergenic
911791277 1:102018546-102018568 TCTCAACTTCTTGGAAATTAAGG + Intergenic
912019855 1:105094236-105094258 TGGGAACTGCTGGGAGTGTAGGG + Intergenic
912668610 1:111605555-111605577 TCTCAACTGCTTGGAATTCATGG + Intronic
913549071 1:119898728-119898750 CGTCAGCTGCTGGGAGTGTAGGG + Intergenic
916466032 1:165075506-165075528 TCACACCTGCTTGTGGTGTAGGG - Intergenic
917786391 1:178462789-178462811 TCACAATTGCTTAGTGTGTACGG + Intronic
917956195 1:180101555-180101577 TGTCCACTGCTTGGTGTGTGGGG - Intronic
921311543 1:213849150-213849172 TAGCAGCTGCTTGGAGTGTTTGG - Intergenic
921453203 1:215334618-215334640 TCTAAACTGATTGGGGTGTGGGG + Intergenic
921914550 1:220592752-220592774 TCTCAACTGCTTGGAGTGTAAGG + Intronic
922417937 1:225438805-225438827 TCCCAACTACTTGGAGGCTAAGG + Intergenic
923640942 1:235759865-235759887 TCCCAGCTGCTTGGAGTCTGAGG - Intronic
924743229 1:246809803-246809825 TCTCACCTGCTTGAACTGGATGG + Intergenic
1064257323 10:13753658-13753680 TCCCAGCTGCTTGGAGGCTAAGG - Intronic
1064745079 10:18470777-18470799 TCTCAAATGCTGGGTGTGGATGG + Intronic
1065208117 10:23376039-23376061 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
1065383393 10:25111840-25111862 TCCCAGCTGCTTGGAGGGTGAGG - Intergenic
1065669371 10:28097852-28097874 TCTCAAATGCTTGTAATTTAAGG + Intronic
1068540796 10:58293064-58293086 TCTCTAATGCTTGAAGGGTAAGG - Intergenic
1072109639 10:92306527-92306549 TCTCAACATCTTGGAATGGAGGG - Intronic
1073424477 10:103447967-103447989 TCTGAAATGCTTGGAGGGCAAGG + Intronic
1073459231 10:103656711-103656733 TCCCAACTACTTGGAGGCTAAGG + Intronic
1075241674 10:120785079-120785101 TTTCAAATGCTTGCATTGTAAGG - Intergenic
1079912429 11:26328027-26328049 TCTCAAGTGCTTGGAGCACATGG - Intronic
1086558611 11:88141301-88141323 TCACAACTGATTGGGGTGTTGGG + Intronic
1091769969 12:3145168-3145190 TGTCAACTGCTTGGACCGTGAGG + Intronic
1094035557 12:26066712-26066734 TCTCCACTTATTTGAGTGTAGGG - Intronic
1094378803 12:29819947-29819969 TCTCAACGGCTTGGAGAACAGGG + Intergenic
1100976022 12:100123459-100123481 TGTCCACTGCTTGGTGTGTGGGG - Intronic
1102373424 12:112401397-112401419 TCTCAGCTACTTGGGATGTAAGG + Intergenic
1104687087 12:130793556-130793578 TGTCAACTACATGGAGTCTAGGG + Intronic
1105050755 12:133048700-133048722 GCCCAACTGCTTGGGGTTTAGGG - Intronic
1109857358 13:68149107-68149129 TCTCATCTAATTAGAGTGTATGG + Intergenic
1110290861 13:73805498-73805520 TCTCAGCTACTTGAAGTCTAAGG + Intronic
1117877818 14:60273915-60273937 TCCCAACTGCTTGGAGGCTGGGG - Intronic
1119609199 14:76047408-76047430 TTCCAACTGCTTGGAGAGAAAGG + Intronic
1120243629 14:81979987-81980009 AGTCCACTGCTTGGAGTGGAGGG + Intergenic
1123031406 14:105453392-105453414 TCTCAACTACTTGGAGGCTGAGG + Intronic
1126382227 15:48060868-48060890 TGTCAACAGCTTAGAGTCTAAGG - Intergenic
1126761077 15:51970864-51970886 TCTCAACTACTTGGAGGCTGAGG + Intronic
1127533273 15:59865587-59865609 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
1128563435 15:68683355-68683377 TCCCACCTGCTTGGAGAGCATGG + Intronic
1128624466 15:69185722-69185744 TGTGCACTGCTTGGTGTGTAGGG - Intronic
1129982806 15:79889756-79889778 TCTCCACTCCTTGGATTGTCAGG + Intronic
1132264450 15:100456046-100456068 TCTCAACTGTTTGGTGTTTCAGG - Exonic
1133167543 16:3958785-3958807 TCTCAGCTACTTGGAGGCTAAGG - Intronic
1135387077 16:22051890-22051912 TGTCCACTGCTTGGTGTGTGGGG + Intronic
1136749811 16:32624157-32624179 TGTCAACTGCAGGGAGTGTCAGG + Intergenic
1141194019 16:81846093-81846115 TCCCAGCTGCTAGGAGTGTTGGG + Intronic
1203051945 16_KI270728v1_random:883355-883377 TGTCAACTGCAGGGAGTGTCAGG + Intergenic
1144444336 17:15313271-15313293 TTTCAACTGCGTGCATTGTATGG + Intronic
1147751402 17:42736715-42736737 TCTCAGCTGCTTGGAGGCTGAGG + Intronic
1151652694 17:75479968-75479990 TCTCAGCTGCTTGGAGGCTGAGG + Intronic
1152852051 17:82642704-82642726 TGTCCACTGCTTGGTGTGTGGGG + Intronic
1153679035 18:7483087-7483109 TCTCCACTGCTTAGAATGAATGG + Intergenic
1156075711 18:33276474-33276496 TCTCAAATGTTTGGAGTTTGAGG + Intronic
1157980931 18:52379643-52379665 CTTCCACTGCTTGCAGTGTAGGG + Intronic
1158876652 18:61740385-61740407 TCACATCTGCTTGGAATGAAAGG - Intergenic
1161142438 19:2655907-2655929 TCTCAGCTGCTTGGAGACTGAGG + Intronic
1162941067 19:14009582-14009604 TCTCAACTACTTGGAGGCTGAGG + Intergenic
1163132795 19:15286206-15286228 TCTCATCTGCTCGGGGTGGAGGG - Intronic
1166383136 19:42365513-42365535 TCTCAGCTTCTTGAAGTGTTGGG - Intronic
931000180 2:57770935-57770957 TCTTAACTATTTGCAGTGTATGG - Intergenic
933997873 2:87683161-87683183 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
936149716 2:110008741-110008763 GTACAAGTGCTTGGAGTGTAGGG + Intergenic
936194962 2:110362628-110362650 GTACAAGTGCTTGGAGTGTAGGG - Intergenic
936295977 2:111267705-111267727 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
936992640 2:118382605-118382627 TTTCAACTGCATGGAAGGTAAGG + Intergenic
938390298 2:130899599-130899621 TCTCACCTGCTTAGAGTCTTTGG - Intronic
938866617 2:135428325-135428347 TCTCAACTACTTGGAGGCTGAGG + Intronic
945420671 2:209632266-209632288 TCTGAACTATTTGGAGTGAAGGG + Intronic
948076534 2:235169191-235169213 TCTAAACTGCATTGAATGTAAGG + Intergenic
1171006235 20:21468000-21468022 CCCCAACTGCATGGAGTGTGGGG - Intergenic
1171104052 20:22415293-22415315 TTTGAACTGCATGGAGTTTATGG + Intergenic
1171305612 20:24103634-24103656 TCTCAATGCCTGGGAGTGTAGGG + Intergenic
1179133399 21:38659497-38659519 TCTAAACTACTTGGAGAGAATGG + Intronic
1180583036 22:16859620-16859642 GTACAAGTGCTTGGAGTGTAGGG - Intergenic
949524030 3:4886019-4886041 TCTCCACGGGTTGGAGTGGAAGG - Intronic
953504028 3:43465535-43465557 TCTCAGCTGCTTGGAGGCTGAGG + Intronic
956834288 3:73083118-73083140 TCCCTACTTCTGGGAGTGTAAGG - Intergenic
958835082 3:99135951-99135973 TCTTAGCTGCTTCGAATGTAGGG + Intergenic
962579691 3:136786719-136786741 TCACAAATGCTTGGCATGTATGG - Intergenic
963994033 3:151685596-151685618 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
964109278 3:153072557-153072579 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
964964952 3:162481291-162481313 TCTGAACTGCCTGGAGTTGATGG + Intergenic
965082556 3:164053610-164053632 TGTCCACTCCTTGGTGTGTAGGG - Intergenic
965177690 3:165356809-165356831 TGTAAACTGCTTGGTGAGTATGG + Intergenic
965656823 3:170995397-170995419 TGTGAACTCCTTGAAGTGTAGGG + Intergenic
966696792 3:182798018-182798040 TCTCAGCTGCTTGGAAGGTTAGG + Intronic
967200903 3:187071642-187071664 TCCCAACTGCTTGGAGGCTGAGG + Intronic
968788100 4:2639361-2639383 TCTAAACTGTTTGAACTGTAAGG + Intronic
970310117 4:14773680-14773702 TATTAATTGCTTTGAGTGTATGG - Intergenic
975786992 4:77901437-77901459 TCTCTGCTTCTTGGAGTGTGTGG - Intronic
985099071 4:186440001-186440023 TCTCAACTGGTTTTGGTGTAAGG + Intronic
989443965 5:41507232-41507254 TCTCACCTGCTTATAGTGAAGGG + Intronic
990232451 5:53728023-53728045 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
992015130 5:72567730-72567752 CCTCAAGTGATTGGAGTGAAGGG - Intergenic
995795489 5:115936835-115936857 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
1002787761 6:417407-417429 ACCCAGCTGCTTGGAGAGTAAGG - Intergenic
1005879556 6:30045463-30045485 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
1008209903 6:48708678-48708700 TCTCCAGTGCTTGCACTGTAAGG + Intergenic
1008725778 6:54417057-54417079 TCTCAACTGGTGGGATAGTATGG + Intergenic
1009931066 6:70178258-70178280 TCCCAACTGCTTGGAGGCTGAGG + Intronic
1010813591 6:80328435-80328457 TCTCAACTTCTTTGGGTTTAGGG - Intronic
1012893699 6:104925368-104925390 TCCCAGCTGCTTGGGGGGTAGGG - Intergenic
1013554493 6:111242073-111242095 TTTCGACTGCATGGAGTGTAGGG - Intergenic
1015593426 6:134843763-134843785 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
1018668314 6:166159837-166159859 TGTCAACAGCTTGCAGTGTGCGG + Intronic
1018925855 6:168206543-168206565 TCTCTCCTGCTTGGAGAGCAGGG + Intergenic
1019034422 6:169042483-169042505 TCTCAGCTGCTGGCAGTGAAGGG + Intergenic
1023658844 7:42453075-42453097 TCTCATCTTCTTGGAGGGTGAGG - Intergenic
1024300115 7:47880754-47880776 TCTCCACTGCTCAGAGAGTATGG + Exonic
1026522010 7:71125842-71125864 TCTCAGCTGCTTGGAGGCTGAGG - Intergenic
1028391044 7:90317416-90317438 AATCAACTGGTTGGAGGGTAGGG - Intergenic
1030586917 7:111432205-111432227 TGTCTGCTGCTTGGAGTGTGGGG + Intronic
1034205374 7:149309948-149309970 TCTCAGCTGCGTGGAGAGTTGGG + Intergenic
1035351738 7:158252161-158252183 CCTCAGCTGCTTGGAGTGGGTGG + Intronic
1035904926 8:3499485-3499507 ACTCCACTGCTTGGAGTGGGGGG + Intronic
1037519141 8:19662778-19662800 TCTCCACTGCTCAGAGTGGATGG - Intronic
1039804451 8:40986591-40986613 TGTCCACTGCTTGGTGTGTGTGG - Intergenic
1040959063 8:53011592-53011614 TATCAAATGCTGGGAGGGTATGG + Intergenic
1041458938 8:58090624-58090646 TTTCAACTGCATGGGGTGGAGGG + Intronic
1047280930 8:123444866-123444888 TCCCAACTCCTTGGTGTGTCAGG - Intronic
1049832566 8:144711430-144711452 TGTCCACTTCCTGGAGTGTAGGG - Intergenic
1050240447 9:3628989-3629011 TCTGAACTGTTAGGATTGTATGG - Intergenic
1052920117 9:33958761-33958783 TCTCAACTACTTGGAGGCTGAGG + Intronic
1053329525 9:37190418-37190440 TTTCAGCTGCTTTGAGTCTAGGG + Intronic
1055912771 9:81371264-81371286 TTTCAACTGCTAGGAGTCTGAGG + Intergenic
1057991170 9:99771734-99771756 TCTCAGCTGCTTGGAGGCTGAGG - Intergenic
1058000443 9:99859663-99859685 TCGCAACTGGTTGGAGAGCAGGG + Intronic
1059220981 9:112618433-112618455 TCTCGAGTACTTGGAGTGGATGG + Intronic
1187545854 X:20251661-20251683 TCTCAACTATTTTAAGTGTATGG + Intronic
1193981157 X:88183526-88183548 TGTAAACTGCTTGGATAGTATGG + Intergenic
1198409735 X:136354531-136354553 TGTCAGCTGCTTGGTGTGTTGGG - Intronic
1199079210 X:143557601-143557623 TCTCAGCTACTTGGAGTCTGAGG + Intergenic