ID: 921917513

View in Genome Browser
Species Human (GRCh38)
Location 1:220628639-220628661
Sequence GTGTAAGAATGAATAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921917513_921917515 -7 Left 921917513 1:220628639-220628661 CCCTCTTCTATTCATTCTTACAC 0: 1
1: 0
2: 3
3: 35
4: 418
Right 921917515 1:220628655-220628677 CTTACACTATTCATTCTTCCTGG 0: 1
1: 0
2: 2
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921917513 Original CRISPR GTGTAAGAATGAATAGAAGA GGG (reversed) Intronic
904876159 1:33656117-33656139 TTGAAAGAAGGAATCGAAGAAGG + Intronic
906250887 1:44310028-44310050 GTGTAAGATTTTATAGATGAAGG - Intronic
907233676 1:53025046-53025068 ATTGAAGAGTGAATAGAAGAGGG - Intronic
908481561 1:64545360-64545382 GTGGGAGAATGAATAGAATAGGG - Intronic
909751927 1:79171919-79171941 ATGTAAGAATGAAAAGATAAAGG - Intergenic
910863421 1:91765300-91765322 CTGAAAGAAGGAATAAAAGAAGG + Intronic
911507628 1:98773222-98773244 GTGTAAGAGGGAAGAGAATATGG - Intergenic
912013286 1:104999386-104999408 GTGTATCAGTGAATAGACGAAGG - Intergenic
913329710 1:117657070-117657092 GTCTATGAATGAATAAAGGAAGG - Intergenic
916923979 1:169498337-169498359 GGGTAAGAATGAGGAGCAGAAGG + Intergenic
917333258 1:173904213-173904235 ATGAAAGAATGAGTAGAAGTAGG - Intronic
917712607 1:177701982-177702004 GTTAGAGAATGAATAGAAGGGGG + Intergenic
917818195 1:178732198-178732220 GTAAAAAAGTGAATAGAAGAGGG + Intronic
918106238 1:181417654-181417676 GTGTGAGAGTGAATAGAAAAGGG - Intronic
918492279 1:185094050-185094072 GAGTAAGAATGAAGAGAAGTAGG - Intronic
920449615 1:206049598-206049620 CTGTAAGGATGAATAGAAAAAGG - Intronic
921168550 1:212525476-212525498 GTGTAAGAAAGAGGAGAAGCTGG - Intergenic
921173424 1:212569409-212569431 GTGGAAAAATGAAAACAAGAAGG - Intronic
921917513 1:220628639-220628661 GTGTAAGAATGAATAGAAGAGGG - Intronic
923186110 1:231575064-231575086 GAGGAAGAATGAATAGACTAAGG - Intronic
923482845 1:234400236-234400258 TTGGAAGACTGAATAGAAAAAGG + Intronic
924152977 1:241147561-241147583 GATTAAGAAAAAATAGAAGATGG + Intronic
924486615 1:244490032-244490054 GTGTGAGGATGAACAGGAGAGGG + Intronic
924570139 1:245230400-245230422 ATGTAAGAATGACCAGAAAATGG + Intronic
1063353983 10:5381109-5381131 GTGTTTGAATGAATAAAACAAGG - Intergenic
1063616482 10:7604479-7604501 GTCTCAGAATGAAAAGAGGACGG - Intronic
1063959401 10:11294457-11294479 GTGTAAGAAGAAAAAGAGGACGG - Intronic
1064008545 10:11716597-11716619 GTTTCAGAAGGAATAGGAGAGGG + Intergenic
1064750037 10:18519279-18519301 GTGGAAAAGTGAATGGAAGAGGG - Intronic
1065408500 10:25394653-25394675 GTGTTAGATGGAAAAGAAGAGGG + Intronic
1065690771 10:28331268-28331290 GTGTAGAAAGGAAGAGAAGAAGG - Intronic
1066123210 10:32311575-32311597 GAGTAAATATGAATAGTAGAAGG - Intronic
1066201754 10:33148561-33148583 ATGAATGAATAAATAGAAGATGG + Intergenic
1067192837 10:44086177-44086199 GAATAACATTGAATAGAAGAGGG + Intergenic
1067714514 10:48679253-48679275 ATGTAAAAATAAAAAGAAGAAGG - Intergenic
1068317460 10:55365171-55365193 GTGTTAGCCAGAATAGAAGATGG + Intronic
1068359406 10:55955948-55955970 GTGAAAGAATAAAGAAAAGAGGG - Intergenic
1068972058 10:62969447-62969469 CTGTAAGAATGAAAGAAAGATGG + Intergenic
1069210329 10:65750442-65750464 GTGTAAGAACTAAAACAAGAAGG - Intergenic
1069788136 10:71002719-71002741 GTGAATGAATGAATAGCACATGG - Intergenic
1070492576 10:76991621-76991643 GTAAAAGAATGAATAAATGAAGG - Intronic
1070748036 10:78946863-78946885 GTTTAAAAATGAATACAAGCTGG + Intergenic
1070953531 10:80449723-80449745 GGGTGAGATTGAACAGAAGAGGG - Intergenic
1073138990 10:101235617-101235639 GAGGAAGAATGGACAGAAGATGG + Intergenic
1074994239 10:118741986-118742008 TTATAAAAATGAATAGAAGTTGG - Intronic
1075972611 10:126667374-126667396 TTAAAAGAATGAATAGAAAAAGG + Intronic
1076477745 10:130764353-130764375 CTGAAGGAATGAATAAAAGAAGG - Intergenic
1076565412 10:131395229-131395251 GTGTTATAAAGAATAGGAGAAGG + Intergenic
1076726342 10:132415931-132415953 GTGTGAGCATGAATGTAAGAGGG - Intronic
1077855299 11:6117868-6117890 GTCTCAAAATGAATAGAAGGAGG + Intergenic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1078336146 11:10464804-10464826 AAGTAAGAATAAATAGGAGATGG - Intronic
1078437395 11:11336899-11336921 GTGAAAGAGAGAATAGAAGAGGG + Intronic
1078450134 11:11434720-11434742 GTGAAAGAATGAAGGGAATAGGG + Intronic
1078652448 11:13208136-13208158 GTGAAAAGATGAATAGAACATGG - Intergenic
1079009157 11:16814234-16814256 GAGTAAGACAGAACAGAAGAAGG + Intronic
1079138920 11:17794768-17794790 GTATAATATTAAATAGAAGAGGG - Intronic
1079251033 11:18788162-18788184 TTGTAAGAATGGTTAGAAAAAGG - Intronic
1079531330 11:21457761-21457783 ATGTGAGAAGGAATAAAAGATGG + Intronic
1079673767 11:23199989-23200011 GTGTAAGAATAAGTGGAAAAGGG - Intergenic
1081237421 11:40662256-40662278 GGGTAAGAATGAATAAGATATGG - Intronic
1081329234 11:41784005-41784027 GTGTAGGAATGTATTTAAGATGG + Intergenic
1081827472 11:46070717-46070739 GAGTAAAAAGAAATAGAAGAAGG + Intronic
1082633024 11:55562756-55562778 TTGTCAGATTGAATAGAAGTAGG - Intergenic
1083446899 11:62714156-62714178 GGTAGAGAATGAATAGAAGAGGG - Exonic
1084163192 11:67362127-67362149 GTGCAAGAATCACTAGAAAAGGG - Intronic
1084585506 11:70059379-70059401 TTGTCAGATTGAATAGAAGTAGG + Intergenic
1086248852 11:84789642-84789664 TAGAAAGAATGAATAAAAGATGG - Intronic
1087166101 11:95004806-95004828 GTTTCAGAATGAATAAAGGAAGG - Intergenic
1089099131 11:115946165-115946187 GTGAAAGATTGACTAGAGGAGGG + Intergenic
1090964823 11:131589513-131589535 GTGTAAGAAAGAAGAGGACAGGG - Intronic
1091005269 11:131947519-131947541 GTGTAAGAAGGAAGAAAGGAAGG + Intronic
1093346492 12:18042356-18042378 GGGTCAGAATGAATTGAAGTGGG + Intergenic
1093715390 12:22376223-22376245 GTGGCATAATGAATGGAAGATGG + Intronic
1093967607 12:25343876-25343898 CTGTAACAATGAATAGGACATGG - Intergenic
1094234344 12:28146392-28146414 GAGAAAGAAAGAAAAGAAGAAGG + Intronic
1094355590 12:29574194-29574216 GTGAATGAATGAATGGAGGAAGG - Intronic
1094470026 12:30795082-30795104 GTGGAAGATTGACTAAAAGAGGG - Intergenic
1094745664 12:33341553-33341575 GGGAAATAATGGATAGAAGAGGG - Intergenic
1095173630 12:39064197-39064219 TTGTATGTATGAATAGATGATGG + Intergenic
1095248470 12:39950099-39950121 GTGTGTGAATGTATAGAAAATGG + Intronic
1097315982 12:58172134-58172156 GAGTAAGACTAATTAGAAGAAGG + Intergenic
1097470293 12:59982527-59982549 GTGCAAGCATGGATAGAAGTTGG + Intergenic
1098085086 12:66833782-66833804 GTGTAAGAATTGAAAGTAGAGGG + Intergenic
1098095320 12:66948320-66948342 GGAGAAGAATGAACAGAAGAAGG - Intergenic
1098359851 12:69643756-69643778 GCCTAAGAATGAGTGGAAGATGG - Intronic
1098743771 12:74208495-74208517 GTGTAGAAAGGAATAGAAGAGGG + Intergenic
1098918703 12:76283158-76283180 AGGTAAGAATGAAAAGGAGAAGG - Intergenic
1099727432 12:86450719-86450741 GTGTAAGAAGGAAAAAAGGAAGG - Intronic
1100034130 12:90230278-90230300 GTGGAGGAATGAATAGAATGTGG - Intergenic
1100657608 12:96663290-96663312 GTGAAGAAATGAAGAGAAGAGGG + Intronic
1100725887 12:97408129-97408151 GAGAAAGAATGATTAGAAGTTGG - Intergenic
1100745150 12:97637426-97637448 GAGAAAGAATGAAAAGAAGAAGG - Intergenic
1100984869 12:100194209-100194231 TTGAATGAATGAATAGAAAACGG - Intergenic
1102452729 12:113053843-113053865 GTGTATGGATGAATGGATGATGG + Intergenic
1102582771 12:113901490-113901512 ATGAATGAATGAATAAAAGAAGG - Intronic
1103184909 12:118948391-118948413 ATGAAGGAAAGAATAGAAGACGG + Intergenic
1103188812 12:118982909-118982931 GTTTAAGAATGAAGGGAAGAAGG + Intronic
1103245354 12:119452036-119452058 GTGGAAGAATGAGTATAATATGG + Intronic
1103671686 12:122621715-122621737 GTGTATGAATGATGAAAAGAGGG - Intronic
1103982480 12:124745728-124745750 GTGAAAGAATGAATGAAGGAAGG + Intergenic
1104500908 12:129284508-129284530 GTGTAAGATGGAATGGAATATGG + Intronic
1104518130 12:129446696-129446718 GTGTAAAACTGATTAAAAGAGGG + Intronic
1104552038 12:129766089-129766111 GTGTAGGAAGGAATAGAAGAAGG - Intronic
1106939087 13:34756683-34756705 CTTTAATAATGAATAGAACAAGG + Intergenic
1107991768 13:45825090-45825112 GTTTAAGAGTGAAGAAAAGATGG - Intronic
1108638667 13:52361462-52361484 GTGGAGCAATGAATAGAACATGG + Intergenic
1108756148 13:53504729-53504751 GTGTAAGAAAGAAAAAAAGAAGG - Intergenic
1108770782 13:53698378-53698400 GTGTAAAAATATATAGAAGAAGG + Intergenic
1109183732 13:59245465-59245487 GAGGGAGAATGAATAGAAAAGGG + Intergenic
1109341922 13:61073450-61073472 GAGAAAGAATGAGGAGAAGATGG + Intergenic
1109505895 13:63302949-63302971 ATGTTAGAATGATGAGAAGATGG + Intergenic
1110021385 13:70478126-70478148 GTGTAAGGATGTGTAGATGATGG - Intergenic
1111094538 13:83495756-83495778 GTGAAAGGATAAACAGAAGATGG - Intergenic
1111228487 13:85308210-85308232 AGGTAAGAATGAAGAGAAGCTGG - Intergenic
1111557182 13:89895834-89895856 GTCTAAGAAAGAAGAGATGAAGG + Intergenic
1111667965 13:91293799-91293821 TTGAATGAATGAATAAAAGAAGG + Intergenic
1112029754 13:95446539-95446561 ATGTTAGAATTAATATAAGAAGG + Intronic
1112806436 13:103168152-103168174 ATGTGAATATGAATAGAAGAGGG - Intergenic
1113762237 13:112857188-112857210 CTGTAAGAATGAAGAGATGGGGG - Intronic
1114916949 14:27280159-27280181 ATGTCAGAATGACTAGAAGTGGG + Intergenic
1117341720 14:54797754-54797776 GAGTAAGCATGCCTAGAAGAGGG + Intergenic
1117766460 14:59088504-59088526 GTGTAAGAATTAGGAGATGATGG - Intergenic
1117933542 14:60874461-60874483 GAGGAAGAATCAATAAAAGATGG - Intronic
1117933550 14:60874581-60874603 GAGGAAGAATCAATAAAAGATGG - Intronic
1117973327 14:61273606-61273628 TTGCAAAAATGAATAGCAGATGG - Intronic
1118698505 14:68409898-68409920 GTGTAAGAAAGAATAAAATTTGG - Intronic
1118812620 14:69286192-69286214 CTGTAAGAAGGGATAGATGAGGG + Intronic
1118916180 14:70108455-70108477 TTGTAAGAATGAAAAGAGGAAGG - Intronic
1119983905 14:79114167-79114189 GGGGAAGAAGGAAGAGAAGAGGG + Intronic
1120448951 14:84641330-84641352 GGGTAAGAATGAATGAAAAAAGG + Intergenic
1120770781 14:88377463-88377485 ATGTAAGAAAAAACAGAAGATGG - Intergenic
1124645514 15:31435262-31435284 TTGTGAGAATGACTAGGAGAAGG + Intronic
1124781701 15:32642254-32642276 GTAGAAGAATGATTAGAAGGAGG + Intronic
1124822776 15:33063841-33063863 GTGTAAGAATGAACAGCATAAGG - Intronic
1125083008 15:35697659-35697681 GTGTAAGAAGAATTAGGAGATGG + Intergenic
1129304150 15:74646557-74646579 TAGTCACAATGAATAGAAGAGGG + Intronic
1129751957 15:78071758-78071780 TTGCATGAATGAATAGAAAATGG - Intronic
1129788441 15:78324264-78324286 GAGAAAGAATGTATGGAAGATGG + Intergenic
1129872566 15:78950029-78950051 GTGGATGAATGAATAGAAGAAGG + Intergenic
1133717059 16:8459921-8459943 GTGGAAGATTGAATAAATGAAGG + Intergenic
1134106068 16:11486702-11486724 GTGGTAGGATGAATAGATGATGG + Intronic
1134653594 16:15929720-15929742 GTATAAGGATGAATATAACAAGG + Intergenic
1134855992 16:17519643-17519665 CTGCAAAAATGAAAAGAAGACGG + Intergenic
1138335679 16:56250986-56251008 GTGAAAGAATGAATATAAGGTGG + Intronic
1139056620 16:63193767-63193789 TTGTAAGTATGAATTGAACATGG - Intergenic
1140329578 16:74041060-74041082 GTATAATAATGAATGGATGAGGG - Intergenic
1140401189 16:74673209-74673231 GAGAAAGAAAGAAAAGAAGAAGG - Intronic
1140897972 16:79341881-79341903 GTGGCAGAATGAACAGAACAGGG + Intergenic
1140943211 16:79742495-79742517 GTATAATATTGAATAGAAGGTGG - Intergenic
1141209569 16:81964732-81964754 GTGTAAGACGGAATAGTATAAGG + Intergenic
1141657925 16:85426008-85426030 CTCTAAGAATGAATGGAAAATGG + Intergenic
1143207959 17:5159190-5159212 GTGAAAGAATCATTAGAATAGGG + Intronic
1144058506 17:11561272-11561294 GTGCAAAAATGAATAAAACAAGG - Exonic
1144201268 17:12944427-12944449 GGGAAAGAATGACTAGAATATGG - Intronic
1149320093 17:55473476-55473498 CTGTCAGATTGAATAGAAGTAGG - Intergenic
1149779975 17:59389635-59389657 GTGAAGGAATGAATAGGAGGAGG - Intronic
1149872410 17:60194809-60194831 GTGAAAGAATCATTAGAATAGGG - Intronic
1150313836 17:64152052-64152074 TTGTAGGAATGATCAGAAGAGGG - Intronic
1150439050 17:65176973-65176995 GTGTACGAATGGATGGAGGAAGG - Intronic
1152301831 17:79499374-79499396 GTGAATGAATGAATAGTGGATGG - Intronic
1153145836 18:2031406-2031428 ATGTAAGAATGAATATGAAAAGG - Intergenic
1153170697 18:2312550-2312572 GAGGAAGAAGGAAAAGAAGAAGG + Intergenic
1154366282 18:13712021-13712043 GTGTAAGAATAAAGAGAAATTGG + Intronic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1155896011 18:31327417-31327439 ATGGAAAAATGAATAGAAAAGGG - Intronic
1156329421 18:36105631-36105653 GTTTAAGAATGAGCAGCAGAGGG - Intergenic
1156814252 18:41290348-41290370 ATGTAAAAATCAACAGAAGATGG + Intergenic
1157651445 18:49336417-49336439 GTAGAAGAATGAAGAGTAGAGGG + Intronic
1158831620 18:61285637-61285659 CTTTCAGAATGAACAGAAGATGG - Intergenic
1159392946 18:67817939-67817961 TTGTAGGAATGAATATAAAATGG - Intergenic
1159502056 18:69285842-69285864 GTTTAAGAAAAAATAGAATAAGG + Intergenic
1159893955 18:73979120-73979142 GTGTAAGAAGGGAGAGAATAAGG - Intergenic
1159985798 18:74839808-74839830 TAGTAATAAGGAATAGAAGAGGG + Intronic
1160332356 18:78006198-78006220 GTGTGAGGATGAATTGCAGAGGG + Intergenic
1160443866 18:78912755-78912777 GTGGAAGAAGGAAAAGAATATGG + Intergenic
1161473034 19:4470468-4470490 CTGGGAGAATGAATAGAAGTTGG - Intergenic
1161827154 19:6575685-6575707 TTGTCAGATTGAATAGAAGCAGG - Intergenic
1162203342 19:9037175-9037197 GTGAATAGATGAATAGAAGATGG + Intergenic
1162639105 19:11993804-11993826 GGGTAAGAATGAAGACAAAAAGG + Intergenic
1163171668 19:15535699-15535721 GTGGATGGATGAATAGCAGATGG - Intronic
1164816749 19:31209964-31209986 GTGGAAGCATGAACAAAAGAAGG + Intergenic
1166975736 19:46604071-46604093 GGGAAAGAATGAAAAGCAGATGG + Intronic
1167634212 19:50644612-50644634 GTGGTTGAATGGATAGAAGATGG + Intronic
925785470 2:7428298-7428320 GTGGAAGAATGCACAGATGAAGG - Intergenic
926260936 2:11260487-11260509 GTGTAAATATATATAGAAGAAGG - Intronic
927322456 2:21762912-21762934 GTGAAATACTGGATAGAAGAGGG - Intergenic
927391443 2:22599927-22599949 GCATAAAAATGAATAAAAGAGGG - Intergenic
927401313 2:22715063-22715085 ATTTAAAAATGGATAGAAGAGGG + Intergenic
928781919 2:34833726-34833748 GTGGAAAAATGAAGAAAAGAAGG + Intergenic
928826020 2:35421960-35421982 GTGTTAGATTGAAAAGAAAATGG - Intergenic
929325226 2:40602133-40602155 TTGTAAGATTGATTAGAGGAAGG - Intronic
929950677 2:46407395-46407417 ATGTGAGAATGAACAGAACACGG + Intergenic
930010447 2:46934037-46934059 GTATAAGAATGATTTGATGAAGG + Intronic
930245802 2:48982247-48982269 GTGTAGGTAAGAAGAGAAGATGG + Intronic
931207007 2:60157535-60157557 CTGAAAGAATGAATGGAAGTTGG - Intergenic
931783362 2:65599815-65599837 CTGAAAGAATGAATAGATGAAGG - Intergenic
932912450 2:75819611-75819633 ATGAATGAATGAATAGATGATGG - Intergenic
933466013 2:82653210-82653232 GAGTAAGAAAAAATAGAAGTTGG + Intergenic
934141743 2:89053647-89053669 TTGTCAGATTGAATAGAAGTAGG - Intergenic
934227500 2:90146899-90146921 TTGTCAGATTGAATAGAAGTAGG + Intergenic
936573818 2:113637151-113637173 CTGTAAGAAGCAATAGCAGAGGG + Intronic
936739988 2:115493460-115493482 GTTTAAGAATCCATATAAGAAGG + Intronic
936912272 2:117605110-117605132 GTGTAAGAATGGAGAGAAGGGGG + Intergenic
938042499 2:128087297-128087319 GGGTAAGAATGCAGAGAAAATGG + Intergenic
939450280 2:142364785-142364807 GTGGAAGGATGATTAGAATAAGG - Intergenic
940924047 2:159344068-159344090 TGGTAAGAATGCATAGAAAAGGG + Intronic
942085432 2:172438911-172438933 TTGGAAGAAGGAAGAGAAGATGG + Intronic
943216293 2:185040629-185040651 ATGTAAGAAAGACTAGAACACGG + Intergenic
943503978 2:188730370-188730392 GTGGTAGAATGAATATAAAAAGG - Intergenic
943572454 2:189589826-189589848 GAGTAAGGATGAAGAGAAGTTGG - Intergenic
943874653 2:193049128-193049150 GAGTAAGAATGAAAAGAGAAGGG - Intergenic
944271465 2:197788366-197788388 GTGTAAGAATTAATAGTAAGAGG - Intergenic
944529072 2:200649794-200649816 GTGCAAGGAGGAAGAGAAGAAGG + Intronic
946120631 2:217510840-217510862 ATCTAAAAATGAATAGAAAATGG - Intronic
946785187 2:223236118-223236140 GAGCAAGAAGGAATGGAAGATGG - Intergenic
946817219 2:223591531-223591553 GTGAGAGACTGAATAGATGAGGG + Intergenic
946922397 2:224593232-224593254 GTGTAAGAAATAATGGAAGTGGG - Intergenic
947244262 2:228029655-228029677 ATGGAAGCATAAATAGAAGATGG + Intronic
948626264 2:239270235-239270257 GTGTAAAAATGAATGGATGACGG + Intronic
948635505 2:239331968-239331990 GCGTAAGAAGGGATACAAGAGGG + Intronic
1168951650 20:1806140-1806162 GAGTAAGAATGAAGAAGAGAAGG - Intergenic
1170914298 20:20607511-20607533 GTATAAAAATTAATAGGAGATGG - Intronic
1171023941 20:21611609-21611631 GTGTAAGAAGTAAGAGAAGTGGG + Intergenic
1171045191 20:21803969-21803991 TTGAAAGAATGAATAGAAATTGG + Intergenic
1172278301 20:33693251-33693273 GTGTCAGAATCAATGGAATATGG - Intergenic
1174275509 20:49400971-49400993 ATGGATGGATGAATAGAAGAAGG - Intronic
1177125305 21:17186169-17186191 TTGCATGAATGAATTGAAGATGG - Intergenic
1178346901 21:31837129-31837151 GTAAAAGAATGAATTGAAGTTGG - Intergenic
1178368629 21:32008813-32008835 GTGGATGAATGAGTAGATGATGG + Intronic
1179433233 21:41339996-41340018 GTTTGAGAATCAATAGGAGATGG + Intronic
1180054136 21:45348513-45348535 ATGTAAGAGTGGATAAAAGAAGG + Intergenic
1180656884 22:17429241-17429263 GTGGTAGAATTAATAGATGAAGG + Intronic
1180862424 22:19092980-19093002 GAGGAAGAAAGAAGAGAAGAAGG + Intronic
1182730082 22:32481881-32481903 GTGTAAAAATGAAAAAAAAAAGG - Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183477247 22:38042408-38042430 GTGGGAGAATGAAAAGAGGAAGG + Intergenic
1184845350 22:47080637-47080659 ATATATGAATGAAAAGAAGAAGG + Intronic
1185011581 22:48317581-48317603 GAGTGACAATGAATAGAAGGAGG + Intergenic
1185426358 22:50773742-50773764 CTGTAAGAAGCAATAGCAGAGGG - Intronic
950339733 3:12232165-12232187 GTGTAAGTTTGAATAAAAAAAGG + Intergenic
950574019 3:13820273-13820295 ATGAAAGAATGAATGGAGGAAGG + Intronic
951394136 3:22143519-22143541 GTGTATGAATCAATAGAAATAGG - Intronic
951635149 3:24766212-24766234 GTGGAAGAAAGAATTGATGATGG - Intergenic
952143932 3:30511176-30511198 TTCTATGAATGAATAGAAAAAGG - Intergenic
952218333 3:31300094-31300116 GTGTAAGGAGGAAGAGAAGAAGG - Intergenic
953067022 3:39482815-39482837 CTGTAACAATGTATATAAGAAGG - Intronic
955831471 3:63008839-63008861 ATGGAAGAATGAAAAGATGAAGG + Intergenic
956341347 3:68227626-68227648 GTGAAAGACTGAATAGAAGATGG + Intronic
957224570 3:77426758-77426780 GTGTAAGGTTGAATTGAACATGG - Intronic
957697363 3:83657433-83657455 GTGTGAAAATGAAGAGAACATGG + Intergenic
958168942 3:89914766-89914788 TTGCACGAATGAATTGAAGATGG + Intergenic
958472646 3:94540839-94540861 GAGTAAGAACTGATAGAAGAAGG - Intergenic
960246640 3:115407096-115407118 GTGTATGAAGGATGAGAAGATGG + Intergenic
961269348 3:125677181-125677203 GTGCAGGACTGATTAGAAGAGGG + Intergenic
961563841 3:127749523-127749545 GAGTAAGGATGAATAAAGGATGG - Intronic
961688127 3:128649765-128649787 GTGTAAGAATGAGAAGCAGCAGG + Intronic
961721659 3:128900922-128900944 GTTTAAGAATGAAAAGAACCAGG - Intronic
961988951 3:131167160-131167182 GATTAATAATGAATAGAAAATGG + Intronic
961989143 3:131168723-131168745 GATTAATAATGAATAGAAAATGG + Intronic
962879511 3:139563030-139563052 GTGAATGAATGAATAAATGAAGG - Intronic
963265857 3:143239349-143239371 CTGAAAGAATGAACGGAAGAAGG + Intergenic
963497790 3:146089597-146089619 GTGTATGAAAAAATGGAAGAAGG - Intronic
963994467 3:151691903-151691925 ATGTAAGAATGAAGTGAAGCAGG - Intergenic
964421699 3:156510606-156510628 ATGGAAGAATGAGTGGAAGAAGG - Intronic
965079749 3:164021045-164021067 GTGTAAGGATGAGGAGAAGGCGG + Intergenic
965138285 3:164802916-164802938 GGGTAAGAATGAAGAGAAGTTGG - Intergenic
965219141 3:165903847-165903869 GTTTAAGAATGGATAGTGGAAGG - Intergenic
966173356 3:177108381-177108403 GGGTAAGAATGGAAAGAATAAGG + Intronic
966298775 3:178455286-178455308 GTGGAAGATTCAATAGAGGATGG - Intronic
967222563 3:187259963-187259985 ATGAAAGAATAAAGAGAAGAAGG - Intronic
967303114 3:188036351-188036373 GCCTAAGAATAAATAAAAGAAGG + Intergenic
967541076 3:190668358-190668380 ATGTAAGCTTGAATAGAGGAAGG - Intergenic
969254337 4:5992209-5992231 GTGAATGAATGAAGAGATGATGG + Intergenic
969971396 4:11052054-11052076 GAGTAAGAATGAACAGAACGAGG - Intergenic
969983349 4:11181268-11181290 TTGAATGAATGAATAAAAGAAGG + Intergenic
970071905 4:12169337-12169359 GTGTAAGAATTTATTGTAGAGGG + Intergenic
970867558 4:20776878-20776900 GGGTAATTATGAATAGATGAAGG + Intronic
970918277 4:21362055-21362077 ATGCAAGAATGAAGAGGAGAGGG + Intronic
971196103 4:24472411-24472433 GTAAAAGAAGGAAGAGAAGAGGG + Intergenic
971348535 4:25835176-25835198 GTGTAAGGATGGGTAGCAGAAGG - Exonic
971570247 4:28203096-28203118 AAGTAAGAATGAATAGAGGGAGG - Intergenic
971595355 4:28520429-28520451 GTGTGAGAATCAGTAAAAGAAGG + Intergenic
971790136 4:31159589-31159611 ATGAAAGAAAGAAGAGAAGAAGG + Intergenic
971964963 4:33541919-33541941 GTGTAAGAAGGAAAGGAGGAAGG + Intergenic
973277162 4:48322278-48322300 CTGAAAGAATGATTAGGAGATGG - Intergenic
974662555 4:64912066-64912088 GTGTGAGAATTAAAACAAGAAGG + Intergenic
975005852 4:69284368-69284390 GAGTAATAATGCATTGAAGAAGG - Intronic
975014266 4:69393320-69393342 GAGTAATAATGCATTGAAGAAGG - Intronic
975389432 4:73799583-73799605 GAGAAAGAATTAATTGAAGAAGG + Intergenic
976069363 4:81223518-81223540 GAGTAAGAATGGTTAGATGAAGG - Intergenic
976123387 4:81806977-81806999 TTTTAAGAATGAAGAGATGAAGG + Intronic
976885487 4:89978611-89978633 TTGTAAGAAAGTTTAGAAGAAGG - Intergenic
978489078 4:109291985-109292007 CTGTAAGCATGACTAGATGATGG - Intronic
978760107 4:112348285-112348307 GTTATAGAGTGAATAGAAGAAGG + Intronic
978959778 4:114662710-114662732 GTGATAAAATGAATAGAAAAGGG + Intronic
980461554 4:133121598-133121620 CAGTAAGTATGAATAAAAGAGGG - Intergenic
980684425 4:136207769-136207791 ATATAAGAAGGAATAGAAAAGGG + Intergenic
981024959 4:140068567-140068589 GTGTTAGAATGAAACGAATATGG + Intronic
981102762 4:140848488-140848510 GGGTAAGAAGGAAAAGAATAAGG - Intergenic
981252680 4:142623214-142623236 GTGTCAGACTGAATTGAAGCAGG - Intronic
981757374 4:148155098-148155120 TTGTAAAAATGAATGAAAGAAGG - Intronic
982176247 4:152708053-152708075 GGATAAGAATGAATTGGAGATGG + Intronic
982337799 4:154259169-154259191 GTGTAAGACTTCATAGAATAAGG - Intronic
983713245 4:170746446-170746468 GTGTTAGAATGAGTGGAAAATGG + Intergenic
984482188 4:180319589-180319611 GTTGAAGAATGAATCGAGGAAGG + Intergenic
985237137 4:187887670-187887692 TTTTAAGAATAAATAGAAAAAGG + Intergenic
985905070 5:2828201-2828223 GTGAAAGAGTGAATTGAAGGGGG - Intergenic
985999113 5:3616323-3616345 GTCTACGAATGGAGAGAAGAAGG + Intergenic
986262878 5:6163796-6163818 GTGTAAGAATGCCTAGAAAGTGG - Intergenic
987739458 5:21887221-21887243 GTGAAAGAAGGGATAAAAGAAGG - Intronic
987742404 5:21927237-21927259 GGGTAAGGAGGAATAGAAGATGG + Intronic
988104121 5:26721288-26721310 ATTTCAGAATGAATAGAAGCAGG - Intergenic
989084800 5:37664545-37664567 GGTTCAGAAGGAATAGAAGATGG - Intronic
989459520 5:41681516-41681538 GTGGAAGAATGAATAGGCCAGGG + Intergenic
989505128 5:42217844-42217866 GGGAAATAATGGATAGAAGAGGG - Intergenic
989512592 5:42305464-42305486 GTGTAACAAAGTATAGAAAATGG + Intergenic
990147706 5:52781310-52781332 ATGTAAGAATGAAGAGAAATTGG - Intergenic
990628447 5:57640863-57640885 GTTAAAGAAGGAAGAGAAGAAGG - Intergenic
992849984 5:80797277-80797299 CTGTAAGCATGAAGAGAACAGGG + Intronic
992994824 5:82322590-82322612 GTGGAAGTGTGAATAGAATAGGG + Intronic
993136198 5:83967465-83967487 CTCTAAGAATGAAAACAAGAGGG + Intronic
993359448 5:86955945-86955967 ATGTAAGAACAAATAGAACAAGG - Intergenic
994916312 5:105983917-105983939 GTGAAAGAATGCATGAAAGAGGG + Intergenic
995616500 5:113970235-113970257 GAGGAAGAATGAAGAGAGGAGGG - Intergenic
995637228 5:114207361-114207383 GTGAAAGGAAGAATAGAAAATGG + Intergenic
995835203 5:116394010-116394032 GTGAAGGGATGAATAGAAGAAGG + Intronic
996705338 5:126492027-126492049 TTGTAAGAATTCATAGAAGCCGG - Intronic
997463907 5:134074010-134074032 GCCTAAGAATGAATAAAAGCTGG + Intergenic
998164501 5:139835271-139835293 ATGGGTGAATGAATAGAAGATGG - Intronic
998462541 5:142320451-142320473 GTGAAAGAGAGAAGAGAAGAGGG - Intronic
998756344 5:145385032-145385054 GTGTAAGAGTGAATTTTAGAGGG + Intergenic
998834381 5:146189906-146189928 GTAGAAGAATAAAGAGAAGAAGG + Intergenic
999047734 5:148487367-148487389 GTGGAAGAAAGAATAGGAGGAGG + Intronic
1000628722 5:163567751-163567773 GAGGAAGAAAGAATAGAAGAGGG - Intergenic
1001394965 5:171411763-171411785 GACTAAGAATGGATAGAAGTGGG - Intergenic
1003831638 6:10018265-10018287 GTGAAGGAATGACTAGAAAAGGG - Intronic
1003891591 6:10568517-10568539 GTGTTAGAATGGTTTGAAGAGGG - Intronic
1004002814 6:11611023-11611045 GAGTAAGAAAGAACAGAATAGGG - Intergenic
1004011127 6:11688565-11688587 ATGTACACATGAATAGAAGAGGG + Intergenic
1005150230 6:22740594-22740616 GTGTAAGAATGGGAAGAAGTTGG + Intergenic
1005582294 6:27246895-27246917 GTTTGAAAAGGAATAGAAGAGGG + Intergenic
1005786115 6:29247613-29247635 TTGTCAGATTGAATAGAAGTAGG + Intergenic
1006989640 6:38203179-38203201 TGGTAAGAATGAAGAGAAAAAGG + Intronic
1007669679 6:43541076-43541098 GTGTAAGGATGGTTAGCAGAGGG + Intronic
1007898483 6:45387041-45387063 GAGTAGGAAACAATAGAAGATGG + Intronic
1008945055 6:57088283-57088305 GTGCAAGAACGAATACAACATGG + Intronic
1009653785 6:66512709-66512731 TGGTGAGAATGTATAGAAGAGGG + Intergenic
1009952001 6:70408565-70408587 GTTTAAAAAAGAATAAAAGAGGG + Intergenic
1010643245 6:78356330-78356352 ATGAAAGAATGAATAAAGGAAGG - Intergenic
1010733349 6:79413709-79413731 GTGTCAGAAAAAATAGGAGAAGG + Intergenic
1011162617 6:84408777-84408799 ATGGAAGAGTGAATAGATGATGG + Intergenic
1011493823 6:87919613-87919635 GAGAAAGAATGAAGAAAAGATGG + Intergenic
1011765905 6:90619372-90619394 GTGTAACCAGGAAGAGAAGAGGG - Intergenic
1012127296 6:95446451-95446473 GAGTAAGAATGTAAAGATGAAGG + Intergenic
1014276307 6:119394188-119394210 TTGCATGAATGAATTGAAGATGG + Intergenic
1016036188 6:139385958-139385980 GTATTTGAATGAATAGAAGCGGG - Intergenic
1016312010 6:142744244-142744266 GTGAAAGAGAGAATAGATGAGGG - Intergenic
1016353765 6:143195570-143195592 ATTTAGGAAGGAATAGAAGAAGG + Intronic
1017263411 6:152414441-152414463 CTGTAAGAATGAAGAGTAAATGG - Intronic
1017349648 6:153425486-153425508 GTGTATGAAAGAATAGTAGTGGG + Intergenic
1018181464 6:161226943-161226965 AAGGAAGAAGGAATAGAAGAAGG + Intronic
1018276431 6:162137012-162137034 GTGTGAAAATGTATAGAAAAAGG + Intronic
1019315927 7:386660-386682 CCGTAAGAAAGAATAGAAAAAGG - Intergenic
1019345600 7:528736-528758 GTGGATGAATGGATAGAAGATGG + Intergenic
1020732445 7:11898677-11898699 ATGAATGAATGAATATAAGAAGG + Intergenic
1020883100 7:13787421-13787443 CTGTAAGATTGAATAAAATAAGG + Intergenic
1020901810 7:14012943-14012965 GAGTAAGACTCAAGAGAAGATGG + Intergenic
1021163772 7:17308209-17308231 GTGAAAGAGAGAAAAGAAGAAGG - Intronic
1021384163 7:20007825-20007847 GTGAAAGACTGAAGAGAAGTAGG + Intergenic
1022857009 7:34324687-34324709 ATGCAAGAATGAATGGAAAATGG + Intergenic
1023333626 7:39145819-39145841 AAGTAAAAATGAATAGAGGATGG - Intronic
1023420868 7:39978173-39978195 GTGGGAGAATGAATATAGGAAGG + Intronic
1024260189 7:47568533-47568555 GTGAATGAATGAATAAAGGAAGG + Intronic
1026013421 7:66654366-66654388 GTCTAAGAGCAAATAGAAGAGGG - Intronic
1026220056 7:68387986-68388008 ATGTCAGACTGAATAAAAGAAGG + Intergenic
1026245436 7:68615423-68615445 ACCTAAGAATGAGTAGAAGAAGG + Intergenic
1027518486 7:79172105-79172127 GTGTAAGAAGGAAGGGAAGAGGG + Intronic
1027881580 7:83845474-83845496 GTTTAAGAATGAATTGGAGAGGG - Intergenic
1028366192 7:90035631-90035653 GTGTATAAATGAAAAGAAGATGG + Intergenic
1028768291 7:94585523-94585545 GTGTAAGAATGAATATGGGCAGG + Intronic
1028827056 7:95285846-95285868 GTGTAAGTAAAAATACAAGATGG - Intronic
1030472650 7:109985825-109985847 GTCTAAGAAAGAATAAATGAAGG + Intergenic
1031701450 7:124931287-124931309 GGGAAAGAATGAATAAAAGAAGG - Intergenic
1031824259 7:126543358-126543380 GTGTCAGAATCACTAGAGGAAGG - Intronic
1032448351 7:132003953-132003975 GTGTAAGAATGTAGAGAGAAGGG + Intergenic
1032565735 7:132941049-132941071 GTGTAAGAATGAATAAAATCAGG - Intronic
1032977315 7:137240535-137240557 ATGTATGAAAGAAAAGAAGAAGG + Intronic
1033231183 7:139599022-139599044 GAATAAGAATGAAAAGAAAAAGG + Intronic
1034090548 7:148360280-148360302 GTGGAAGAAGGAGAAGAAGAAGG + Intronic
1035827752 8:2662454-2662476 CTGTAAGATTGAATACAAGATGG + Intergenic
1035929897 8:3768595-3768617 GTGTAACATTAAATAGAAGCAGG + Intronic
1037235890 8:16719213-16719235 ATGTATGAATGAATAAAAGCAGG + Intergenic
1038182045 8:25238445-25238467 GAGTTAGAATGAATAGATGACGG + Intronic
1041191118 8:55355285-55355307 GTGAGAAGATGAATAGAAGACGG + Intronic
1041914966 8:63129502-63129524 GTGTAAGAACTAAAAGAAGGCGG - Intergenic
1042463603 8:69100480-69100502 GTGAAAGAATGAATAAGTGAAGG - Intergenic
1043109343 8:76158900-76158922 ATGTATCAATGAATAGATGATGG - Intergenic
1043671246 8:82887681-82887703 GTGTAAGAATAAATAAAATTGGG + Intergenic
1045050676 8:98321307-98321329 GTGTAGGAAGGAATGGCAGAGGG + Intergenic
1045450953 8:102324628-102324650 ATGTAAGAAACAAAAGAAGATGG + Intronic
1045999077 8:108397679-108397701 ATATAACAATGAATAGAACAGGG - Intronic
1046361263 8:113160027-113160049 GTGAAAGAGTAAATAGATGATGG + Intronic
1046593931 8:116238271-116238293 ATGAATGAATGAATACAAGAGGG + Intergenic
1047674926 8:127190884-127190906 AGGAAAGAATGAAGAGAAGAAGG + Intergenic
1047787946 8:128172474-128172496 ATGGAAGAATGAATAGGGGAAGG + Intergenic
1047794531 8:128240779-128240801 TTGCAAGAATGACTAAAAGAAGG - Intergenic
1047839508 8:128735292-128735314 TTGAAATTATGAATAGAAGAAGG - Intergenic
1048662126 8:136616762-136616784 GTGTAAGAATGGAGAAAAGGTGG - Intergenic
1048878290 8:138853695-138853717 GTGTAAGAAAGAAAAGAAAAAGG + Intronic
1048898963 8:139020076-139020098 GTGCAAGAAGGAAGAGAAGGTGG + Intergenic
1049922990 9:382433-382455 GTTTAAGAAGGAATTGAAGAGGG - Intronic
1050140919 9:2514789-2514811 TTGTCAGATTGAATAGAAGAAGG - Intergenic
1050760921 9:9069721-9069743 GTGTTAGAATGTAAAGATGAAGG + Intronic
1050963091 9:11762643-11762665 GTATAAGAATTAATAAAAGCTGG - Intergenic
1051465997 9:17378477-17378499 ATGTAAGAAAGAACAAAAGAAGG - Intronic
1051831023 9:21276858-21276880 GTGGAAGCATGAATCAAAGAAGG - Intergenic
1051968340 9:22857153-22857175 GTGGAAGAATGGAGAGAAGAGGG - Intergenic
1052865232 9:33460770-33460792 GCTCAAGAATGAATAGCAGAGGG + Intergenic
1052882894 9:33615746-33615768 GTGTAGGAATCTATGGAAGATGG + Intergenic
1054979875 9:71193391-71193413 GAGTTTGAATGAATAGAAGAGGG - Intronic
1055449225 9:76415975-76415997 GGGAAATACTGAATAGAAGAGGG + Intergenic
1057621870 9:96643545-96643567 GTGTAAGAATAAAGAGTACATGG - Intronic
1057628829 9:96702548-96702570 GTCTAAGAAAGAATAAAAAAGGG + Intergenic
1057821622 9:98335837-98335859 GTGCATGAATGAATGGATGATGG - Intronic
1058934744 9:109758799-109758821 TTGTAGGAAAGAATAGAGGAAGG - Intronic
1059351263 9:113666804-113666826 GTGAAAGAATGAATAAATGCAGG - Intergenic
1059780312 9:117519050-117519072 GTGTAAGAATGCTTAGAATAGGG + Intergenic
1060559250 9:124529394-124529416 GTGTAAGAATGCATATGAAAAGG - Intronic
1060748347 9:126152477-126152499 GTGAAATCATGAATGGAAGATGG - Intergenic
1062433721 9:136536882-136536904 CTGTAAGAATGCAAAGTAGAGGG - Intronic
1185636734 X:1557615-1557637 ATGGATGGATGAATAGAAGATGG - Intergenic
1186273075 X:7910418-7910440 GTGAATGAATGAATGAAAGATGG + Intronic
1186280173 X:7984406-7984428 GTGACAGAATGAAGAAAAGATGG - Intergenic
1186655702 X:11609554-11609576 GTTTAAGAAGGAAGAGAAGCAGG + Intronic
1187270025 X:17771657-17771679 ATGTAGGAATGAATATCAGAAGG - Intergenic
1187599037 X:20806393-20806415 TTGAAAGATTGAATAGAACAAGG + Intergenic
1187889010 X:23915993-23916015 GTGTAAGACTGAATACAGAATGG - Intronic
1188116804 X:26254519-26254541 TTGCATGAATGAATTGAAGATGG - Intergenic
1188446723 X:30260592-30260614 GTGCAAGAAGGAATAGAATTTGG + Intergenic
1188663401 X:32789100-32789122 GTGAAGCAATAAATAGAAGAAGG + Intronic
1189222256 X:39382507-39382529 AAGTAAGAAGAAATAGAAGATGG - Intergenic
1189533969 X:41917011-41917033 ATGAAAGAATGAATAGTATATGG + Intronic
1190599721 X:52077987-52078009 GAGAAAGCATGAATAGGAGAAGG + Intergenic
1190991779 X:55558445-55558467 GTCTAGGTATGATTAGAAGATGG + Intergenic
1191804805 X:65123467-65123489 GTATTCAAATGAATAGAAGAAGG - Intergenic
1193056594 X:77159045-77159067 ATGTAAGAATGTATAAAAAATGG + Intergenic
1193401553 X:81050838-81050860 GTGGAAGAATGAATAGTTAAAGG + Intergenic
1194057560 X:89155382-89155404 GTTTAAAAATAAATAGAAGTTGG + Intergenic
1194307323 X:92264183-92264205 GTGTGAGAATTAATGGAAAATGG + Intronic
1195139639 X:101946370-101946392 GTGTTGGAAAGAATAAAAGAAGG - Intergenic
1195745826 X:108116953-108116975 GGCTAAGGAAGAATAGAAGAGGG - Intronic
1197374966 X:125671621-125671643 ATGTAAGATTCAATAGAAAATGG - Intergenic
1197670980 X:129277001-129277023 GTGTAAAAATGAAGAGGAAATGG + Intergenic
1199109060 X:143908815-143908837 ATGTGAGAATGAATTGGAGAAGG - Intergenic
1199505242 X:148554008-148554030 GTCTAAGAATGAATAGAGTGTGG + Intronic
1201433002 Y:13924621-13924643 GTGTAAAATTGAATAGAACCAGG - Intergenic