ID: 921918510

View in Genome Browser
Species Human (GRCh38)
Location 1:220641227-220641249
Sequence GAATTTTGGCAGAGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 522}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921918510_921918521 24 Left 921918510 1:220641227-220641249 CCCTGCACCCTCTGCCAAAATTC 0: 1
1: 0
2: 3
3: 42
4: 522
Right 921918521 1:220641274-220641296 GGTGGTAGTATTAGAAGGCAGGG 0: 1
1: 0
2: 6
3: 73
4: 454
921918510_921918516 6 Left 921918510 1:220641227-220641249 CCCTGCACCCTCTGCCAAAATTC 0: 1
1: 0
2: 3
3: 42
4: 522
Right 921918516 1:220641256-220641278 TAAAATTCTAACCCTAAAGGTGG 0: 1
1: 1
2: 1
3: 23
4: 191
921918510_921918520 23 Left 921918510 1:220641227-220641249 CCCTGCACCCTCTGCCAAAATTC 0: 1
1: 0
2: 3
3: 42
4: 522
Right 921918520 1:220641273-220641295 AGGTGGTAGTATTAGAAGGCAGG 0: 1
1: 0
2: 19
3: 142
4: 779
921918510_921918519 19 Left 921918510 1:220641227-220641249 CCCTGCACCCTCTGCCAAAATTC 0: 1
1: 0
2: 3
3: 42
4: 522
Right 921918519 1:220641269-220641291 CTAAAGGTGGTAGTATTAGAAGG No data
921918510_921918515 3 Left 921918510 1:220641227-220641249 CCCTGCACCCTCTGCCAAAATTC 0: 1
1: 0
2: 3
3: 42
4: 522
Right 921918515 1:220641253-220641275 TGTTAAAATTCTAACCCTAAAGG 0: 1
1: 2
2: 28
3: 169
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921918510 Original CRISPR GAATTTTGGCAGAGGGTGCA GGG (reversed) Intronic
900575420 1:3380113-3380135 GCATGTTAGGAGAGGGTGCACGG - Intronic
900725257 1:4212380-4212402 CAATCTTGGCAGAAGGTGAAAGG + Intergenic
902032889 1:13435847-13435869 GAAATGTGGGGGAGGGTGCAGGG - Intergenic
902687765 1:18089936-18089958 GGATTTTGCCAGAGGGTGTGGGG + Intergenic
902705044 1:18198900-18198922 GCATCTGGGCAGAGGGGGCAGGG - Intronic
904337472 1:29807458-29807480 GGATCATGGCAGAGGGTGAAAGG - Intergenic
904787824 1:32995845-32995867 GCAGGTTGGCAGAGGGTGCAAGG + Intergenic
906279822 1:44545576-44545598 AAAGCCTGGCAGAGGGTGCAAGG + Intronic
907508699 1:54942384-54942406 CAATTATGGCAGAAGGTGAAAGG - Intergenic
907771671 1:57471675-57471697 CAATTATGGCAGAAGGTGAAAGG - Intronic
907781689 1:57572808-57572830 TAATCTTGGCAGAAGGTGAAGGG + Intronic
908397169 1:63736329-63736351 GTATTTTGACAGGGGTTGCATGG + Intergenic
909177845 1:72382450-72382472 GAATCATGGCAGAGGGTGAAAGG - Intergenic
909834829 1:80240758-80240780 CAATTATGGCAGAAGGTGAAGGG - Intergenic
909987619 1:82182078-82182100 GAATTAAGGCAGAGAGCGCATGG + Intergenic
910774665 1:90862883-90862905 GAATTGTGGCAGGAGGTGAAAGG + Intergenic
911224000 1:95284269-95284291 GCATTTTGGTAGTGAGTGCAAGG - Intergenic
911314268 1:96337453-96337475 CAATTATGGCAGAAGGTGAAGGG + Intergenic
911819770 1:102402941-102402963 GAATCATGGCAGAAGGTGAAGGG + Intergenic
911971196 1:104440059-104440081 GAATTTTGGCAGAGAATGGGTGG + Intergenic
913684669 1:121220410-121220432 GAAGCTGGGCAGAGGGTGGAAGG + Intronic
914036505 1:144008026-144008048 GAAGCTGGGCAGAGGGTGGAAGG + Intergenic
914152949 1:145059920-145059942 GAAGCTGGGCAGAGGGTGGAAGG - Intronic
915432908 1:155880453-155880475 GAATCCTGGCAGAGGGTGCAGGG - Intronic
915923333 1:159995432-159995454 GAATCATGGCAGAAGGTGAAAGG + Intergenic
918266688 1:182848806-182848828 GAATGATGGCAGAAGGTGAAGGG + Intronic
919253145 1:195085208-195085230 GTGGTTTGGCAGAGGGTGGATGG - Intergenic
919708548 1:200703223-200703245 GAAATTGGGCAAAGGGTACAAGG + Intergenic
920471980 1:206238960-206238982 GAAGCTGGGCAGAGGGTGGAAGG + Intronic
920677051 1:208045466-208045488 AAATTTTGGGGGAGGATGCATGG + Intronic
921886245 1:220309490-220309512 TAATTTTTGCATAAGGTGCAAGG - Intergenic
921918510 1:220641227-220641249 GAATTTTGGCAGAGGGTGCAGGG - Intronic
922001210 1:221480361-221480383 CAATTATGGCAGAAGGTGAAGGG + Intergenic
922212306 1:223495579-223495601 GAATTTAGGCAGTGGCTGTAGGG - Intergenic
922629537 1:227091456-227091478 CAATCATGGCAGAAGGTGCAAGG - Intronic
923904392 1:238366713-238366735 GAATTTTGACAATGTGTGCAAGG + Intergenic
924020078 1:239771678-239771700 TAATTATGACAGAGGCTGCATGG - Intronic
1063294834 10:4794752-4794774 TAATTTTTGCATAAGGTGCAAGG + Intronic
1063749223 10:8923879-8923901 CAATCATGGCAGAAGGTGCAAGG + Intergenic
1064678638 10:17786993-17787015 CAATCATGGCAGAGGGTGAAAGG - Intronic
1064750399 10:18522522-18522544 GACTTTTGGCAGGGGAGGCAAGG + Intronic
1065240352 10:23697504-23697526 TAAATTTGGCAGGGGGTGGAGGG - Intronic
1065375486 10:25036335-25036357 TAATTCTGGCAGAAGGTGAAAGG - Intronic
1065689534 10:28319117-28319139 CAATCATGGCAGAGGGTGAAGGG + Intronic
1066012185 10:31205081-31205103 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1066451733 10:35536260-35536282 GAATCATGGCGGAGGGTGAAAGG - Intronic
1067021648 10:42805221-42805243 GATTTTCAGCAGATGGTGCAGGG - Intronic
1067663398 10:48253276-48253298 TAATTTTTGCATAAGGTGCAAGG - Intronic
1068158882 10:53237808-53237830 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1068175353 10:53449660-53449682 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1069114514 10:64488758-64488780 TAATTATGGCAGAAGGTGAAGGG + Intergenic
1069424379 10:68276964-68276986 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1069920356 10:71812235-71812257 GACTTTGGGCAGTGGGTGCAGGG + Intronic
1069969730 10:72156261-72156283 CAATTATGGCAGAAGGTGAAGGG - Intronic
1071497367 10:86178444-86178466 GATTTTTGGCAAACGGTGCTGGG + Intronic
1071911239 10:90236508-90236530 GAAACTTGGTGGAGGGTGCAGGG - Intergenic
1072526708 10:96277904-96277926 TAATAATGGCAGAGGGTGAAAGG - Intergenic
1072977521 10:100071975-100071997 GAATTTTGGCGAAGGGTGGTAGG + Intronic
1073983561 10:109182627-109182649 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1074377107 10:112949990-112950012 GGATTCTGGGCGAGGGTGCAGGG - Intergenic
1074387962 10:113032140-113032162 GACTTTTGGGAGAGGGTGGAAGG + Intronic
1074419689 10:113298026-113298048 GAATGTTGGCAGATGATGAAAGG - Intergenic
1075043679 10:119128732-119128754 CAATCATGGCAGAGGGTGAAGGG + Intronic
1075245138 10:120814890-120814912 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1075988484 10:126810421-126810443 CAATCATGGCAGAGGGTGAAAGG - Intergenic
1078143535 11:8708151-8708173 GCAGTTTGGCAGAGGCTACAGGG + Intronic
1078376370 11:10796629-10796651 GAATTTTTCCAGAGGAAGCAGGG + Intergenic
1078724056 11:13912691-13912713 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1080347286 11:31339205-31339227 GAAATTTGGCAGGGGGTGGAGGG - Intronic
1080591931 11:33732083-33732105 CAATCATGGCAGAGGGTGAAAGG - Intronic
1081043098 11:38235899-38235921 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1082893997 11:58170762-58170784 CAATTATGGCAGAAGGTGAAAGG - Intronic
1084007292 11:66330097-66330119 GAATGTTTGTAGAGGGTGCTCGG - Intergenic
1085022081 11:73216301-73216323 GAATTTAAGGATAGGGTGCAGGG + Intergenic
1085069141 11:73526342-73526364 TAATGTTGGCAGGGTGTGCAAGG + Intronic
1085948927 11:81305952-81305974 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1086393656 11:86391884-86391906 CAATCATGGCAGAAGGTGCAGGG + Intronic
1086804655 11:91225406-91225428 GAATTTTTGTATAGGGTGTAAGG - Intergenic
1086835967 11:91623012-91623034 AAATTTTGGCAGGGGGTGTGAGG - Intergenic
1087325058 11:96711406-96711428 CAATTGTGGCAGAAGGTGAAAGG - Intergenic
1087807411 11:102569787-102569809 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1088906994 11:114162576-114162598 GAGAGTGGGCAGAGGGTGCATGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089598249 11:119596261-119596283 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1089631154 11:119785258-119785280 GAAATGTGGCAATGGGTGCATGG - Intergenic
1091008741 11:131978694-131978716 GTATTTTGGTAGAGGATGCATGG - Intronic
1091324170 11:134671717-134671739 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1091888202 12:4031764-4031786 GAAGTTGGGGAGAGGGCGCAGGG - Intergenic
1092006863 12:5077400-5077422 AAATGTTGGCAGTAGGTGCAGGG + Intergenic
1092872938 12:12822933-12822955 CAATTATGGCAGAAGGTGAAGGG + Intronic
1092945411 12:13449821-13449843 GAATTTGGGCAGAGGCAGAAGGG - Intergenic
1095297477 12:40543407-40543429 GAATTTTGCCAGAGGGAGTGGGG - Intronic
1095749236 12:45693231-45693253 GAATCATGGCAGAAGGTGAAGGG + Intergenic
1095978507 12:47956430-47956452 GAATCATGGCAGAAGGTGAAGGG - Intergenic
1097955977 12:65485492-65485514 TAATCATGGCAGAGGGTGAAGGG + Intronic
1098096769 12:66965084-66965106 GAATTTTGGGAGCAGGGGCAGGG + Intergenic
1098769490 12:74535780-74535802 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1098927020 12:76361657-76361679 TAATCATGGCAGAGGGTGAAAGG + Intronic
1099700091 12:86073230-86073252 CAATTGTGGCAGAAGGTGAAAGG - Intronic
1100609676 12:96181004-96181026 GAATCATGGCAGAAGGTGAAAGG + Intergenic
1100672445 12:96831481-96831503 TAATTTTGGCAGAGACTGTATGG + Intronic
1101374897 12:104163117-104163139 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1101688538 12:107050546-107050568 CAATTGTGGCAGAAGGTGAAAGG - Intronic
1103128619 12:118446918-118446940 GAATTTTGGTAGTGGGTGGTGGG + Intergenic
1103527964 12:121580099-121580121 GCATTTTGGCCGAGGGGGGAAGG + Intronic
1103603368 12:122068549-122068571 GAATTTTGTGATAAGGTGCAAGG - Intergenic
1104042654 12:125140375-125140397 GTATTTTGCCAGCGGGTGGAAGG + Intronic
1104135610 12:125935087-125935109 AAATCATGGCAGAGGGTGAAGGG - Intergenic
1104188024 12:126451033-126451055 GAATCATGGCAGAAGGTGAAAGG - Intergenic
1105980059 13:25510375-25510397 GGAATTTGGCAGAGGATGAAAGG + Intronic
1106128150 13:26917854-26917876 TAACTTTGGGAGAGGGTACATGG - Intergenic
1106869043 13:33998994-33999016 GCATTTTGGTAGAGGGAGAAGGG + Intergenic
1107084535 13:36412373-36412395 GAATTGTTGCAGAAGGTGAAGGG + Intergenic
1108575614 13:51788007-51788029 GAATTTTGTCAGATGGTGGGTGG + Intronic
1109721670 13:66283338-66283360 AAATATAGGCAGAGGCTGCATGG + Intergenic
1109920491 13:69051771-69051793 AAATTATGGCAGAAGGTGAAGGG - Intergenic
1110439812 13:75515512-75515534 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1111221213 13:85207535-85207557 GAATCATGGCAGAAGGTGGAGGG - Intergenic
1111790377 13:92847544-92847566 CAATTATGGCAGAAGGTGAAGGG - Intronic
1112307303 13:98286553-98286575 AAATTATGGCAGAAGGTGAAAGG - Intronic
1114197395 14:20490967-20490989 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1114614286 14:24060049-24060071 GACGTCTGGCAGAAGGTGCAGGG + Exonic
1114752700 14:25223387-25223409 CAATTATGGCAGAAGGTGAATGG + Intergenic
1114773532 14:25455756-25455778 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1115894473 14:38070196-38070218 GATATATGGCAGAGGGTGGAGGG + Intergenic
1116167985 14:41358502-41358524 GAATTATGGCAGGAGGTGAAAGG - Intergenic
1116211693 14:41954564-41954586 CTATTGTGGCAGAGGGTGAAGGG + Intergenic
1117988714 14:61413421-61413443 GAATATAGGCACAGGGTACATGG - Intronic
1118024606 14:61756271-61756293 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1118248173 14:64132303-64132325 GTATTTTGGCAGAGTATGCTTGG - Exonic
1118491334 14:66263555-66263577 TAATTATGGCAGAAGGTGAAGGG - Intergenic
1119599076 14:75962584-75962606 GAATTTGAGCAGAGGCTTCAAGG - Intronic
1119880830 14:78098204-78098226 CAATTATGGCAGATGGTGAAAGG + Intergenic
1120146864 14:80988337-80988359 CAATTATGGCAGAAGGTGAAGGG + Intronic
1120454538 14:84715557-84715579 TAATCATGGCAGAGGGTGAAAGG - Intergenic
1120696801 14:87653936-87653958 GAATTTTGGCAGCTGGTGGGTGG + Intergenic
1120761155 14:88286653-88286675 CAATTATGGCAGAAGGTGAAAGG + Intronic
1121152864 14:91653547-91653569 CAATCATGGCAGAGGGTGGAAGG + Intronic
1121252713 14:92511741-92511763 GAATCTGGGCAGAGGGGGAAGGG + Intergenic
1121384634 14:93509062-93509084 CAATAATGGCAGAAGGTGCAGGG + Intronic
1122847564 14:104508477-104508499 GATTTTTAGCAAAGGCTGCAAGG + Intronic
1123541560 15:21296999-21297021 GAATCTGGGCAGAGTGTACAAGG + Intergenic
1123930788 15:25170816-25170838 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123931245 15:25172728-25172750 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123932928 15:25180590-25180612 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123933783 15:25184399-25184421 GAATTTTGGAAGAGGACGCTGGG + Intergenic
1123934069 15:25185724-25185746 GAATTTTGAAAGAGGATGCTGGG + Intergenic
1123934505 15:25187628-25187650 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123935370 15:25191509-25191531 GAATTTTGGAAGAAGGTGCTGGG + Intergenic
1123935773 15:25193414-25193436 GAGTTTTGGAAGAGGATGCTGGG + Intergenic
1123936138 15:25195013-25195035 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123936734 15:25197668-25197690 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123938010 15:25203320-25203342 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123938273 15:25204450-25204472 GAATTTTGGAAGAGGATTCTCGG + Intergenic
1123939090 15:25208175-25208197 GAATTTTGGAAGAGGACGCTGGG + Intergenic
1123940777 15:25215634-25215656 GAGTTTTGGAAGAGGATGCTGGG + Intergenic
1123941473 15:25218710-25218732 GAATTTTGGAAAAGGATGCTGGG + Intergenic
1123942487 15:25223339-25223361 GAATTTTGGCAGAGGATGCCGGG + Intergenic
1123944906 15:25234340-25234362 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123947004 15:25243707-25243729 GAACTTTGGAAGAGGATGCTGGG + Intergenic
1123947815 15:25247438-25247460 GAATTTTGGAAGAGGATGCTGGG + Intergenic
1123974858 15:25543608-25543630 GAATTTTCCCAGGGGGTGGAAGG - Intergenic
1124158306 15:27247719-27247741 CAATCATGGCAGAGGGTGAAAGG + Intronic
1124888768 15:33712082-33712104 CAATTGTGGCAGAAGGTGAAGGG + Intronic
1125207393 15:37169534-37169556 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1126197548 15:45949116-45949138 CAATTATGGCAGACGGTGAAGGG - Intergenic
1126695385 15:51321371-51321393 GGATTGTGGCAGAGGGAGCAGGG - Intronic
1127277196 15:57457615-57457637 TAATCGTGGCAGAGGGTGAAAGG + Intronic
1128943831 15:71808679-71808701 GCTTTTTGGCAGAGGAGGCAGGG + Intronic
1130430426 15:83841954-83841976 GAAATTTGGCCGAGGGCGGACGG + Intronic
1130775204 15:86971981-86972003 GAATCATGGCAGAAGGTGAAGGG - Intronic
1131101594 15:89694844-89694866 TAATTTTTGCATATGGTGCAAGG + Intronic
1132215016 15:100056198-100056220 AAATATAGGCAAAGGGTGCATGG + Intronic
1202949877 15_KI270727v1_random:24141-24163 GAATCTGGGCAGAGTGTACAAGG + Intergenic
1134095975 16:11418742-11418764 GCATTGTGGCAGAGACTGCAGGG + Intronic
1135477301 16:22788151-22788173 GGCATTTGGCAGAGGGTGAATGG + Intergenic
1135661361 16:24299830-24299852 GAAATTTGGGAGAGGGGGTAGGG + Intronic
1135950442 16:26909453-26909475 GACTTCTGGCAGAAGGTGAAGGG - Intergenic
1136069551 16:27779527-27779549 GACATGTGGCAGAGAGTGCAGGG - Exonic
1137002343 16:35240293-35240315 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1137622837 16:49887630-49887652 GCATTTTGGCAGAGTGAGGAGGG + Intergenic
1138769263 16:59643643-59643665 GAATTATGGCAGAAGGTGAAGGG - Intergenic
1138828302 16:60348151-60348173 CAATTGTGGCAGAAGGTGAAGGG + Intergenic
1138850720 16:60626651-60626673 GGAGTGGGGCAGAGGGTGCAGGG + Intergenic
1139165957 16:64565680-64565702 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1139209521 16:65063790-65063812 GAATTTTGGCATTGGGTACCAGG + Intronic
1140566289 16:76046721-76046743 CAATCATGGCAGAAGGTGCAGGG + Intergenic
1140627376 16:76810546-76810568 GAATCATGGCAGAAGGTGAAGGG + Intergenic
1141224254 16:82100387-82100409 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1141381281 16:83579415-83579437 CAATTATGGCAGAAGGTGAAGGG + Intronic
1143273903 17:5695838-5695860 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1144997214 17:19278387-19278409 GAATTATGGCAGGAGGTGAAAGG + Intronic
1149047128 17:52259197-52259219 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1149394077 17:56221065-56221087 GAATCATGGCAGAAGGTGAAGGG + Intronic
1150545110 17:66148404-66148426 GAATTTTGACAGAGATTGTATGG + Intronic
1150941307 17:69697388-69697410 GAATCATGGCAGAAGGTGAAAGG + Intergenic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1152939411 17:83160324-83160346 GCTTTTGGGTAGAGGGTGCAAGG - Intergenic
1153209609 18:2746499-2746521 AAACTTTGGCAGAGGGAACATGG + Intronic
1153506241 18:5802471-5802493 TAATTATGGCAGAAGGTGAAGGG - Intergenic
1153679202 18:7484369-7484391 GGAACTTGGCAGGGGGTGCAGGG + Intergenic
1153839588 18:8994364-8994386 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1154504536 18:15022062-15022084 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1154998092 18:21660302-21660324 GAAACTTGCCACAGGGTGCAAGG - Intronic
1155583209 18:27335734-27335756 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1156332458 18:36136198-36136220 GAATCTAGGTAGAGGGTACAGGG + Intronic
1156439511 18:37169897-37169919 GAATTTTAACAGATGGTCCAGGG - Intronic
1156946560 18:42840181-42840203 GTATTTTGGCAGAGACTGAAAGG - Intronic
1157068768 18:44381899-44381921 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1157454286 18:47812304-47812326 CAATTATGGCAGAAGGTGAAGGG - Exonic
1158307024 18:56117084-56117106 GAATTTTGGCAGAGACTCGAAGG - Intergenic
1158667431 18:59445205-59445227 TAATTTTTGCAGATGGTGTAAGG + Intronic
1158674992 18:59510253-59510275 GAGTTCTGACAGAGGGAGCAGGG + Intronic
1159153493 18:64552326-64552348 TAATTTTAGAAGAGGGTGAATGG + Intergenic
1159769725 18:72535548-72535570 GAACCTTGGCAGATGCTGCAGGG + Intergenic
1159846721 18:73469935-73469957 TAATTTTTGCAGAAGGTGTAAGG + Intergenic
1160352962 18:78200801-78200823 TACTCTTGGCAGAGGGTGAAAGG + Intergenic
1161827436 19:6577854-6577876 GCATTCTGGAAGAGGGTGCTGGG - Intergenic
1163617575 19:18338855-18338877 GAATGTTGGCAGAATGTGCCTGG + Intergenic
1164404366 19:27930171-27930193 CAATTGTGGCAGAAGGTGAAAGG + Intergenic
1164814783 19:31187716-31187738 GATTTTTGGCAAAAGCTGCAAGG - Intergenic
1166920274 19:46224459-46224481 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1167847134 19:52173795-52173817 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1167969893 19:53182680-53182702 GAACTTGGGAAGAGGCTGCACGG - Intronic
1168101360 19:54143172-54143194 GATATTTGGCAGAAGGTACAGGG + Exonic
925336668 2:3103375-3103397 GGAGTGTGGCAGAGGGTGGAGGG - Intergenic
925522102 2:4758394-4758416 CAATCATGGCAGAGGGTGAAAGG + Intergenic
925794312 2:7526250-7526272 CAATTATGGCAGAAGGTGAAGGG + Intergenic
925838925 2:7972569-7972591 CAATTATGGCAGAAGGTGAAGGG - Intergenic
925871957 2:8279235-8279257 GAAGCTTGGCAGAGGCAGCAGGG - Intergenic
926047182 2:9718233-9718255 GAATTATGGCAGGAGGTGAAAGG + Intergenic
926415569 2:12646334-12646356 CAATTATGGCAGAGGGTGAAAGG + Intergenic
927608596 2:24513161-24513183 TAAGTTGGGCAGAAGGTGCACGG - Intronic
928836366 2:35551560-35551582 TAATTGTGGTAGAGGGTGAAGGG + Intergenic
929333697 2:40714329-40714351 GAATTTTATCAGGGGGTGGAGGG - Intergenic
929803953 2:45128242-45128264 GGCTTTTTGCAGAGGGTGGATGG - Intergenic
929940814 2:46332765-46332787 GATTTCTGGCAGAGGATGCCAGG - Intronic
930405002 2:50943142-50943164 CAATCATGGCAGAAGGTGCAGGG - Intronic
930520581 2:52461318-52461340 GAAGTTGGGAAAAGGGTGCAAGG + Intergenic
931963196 2:67504336-67504358 GAATTATGGCAGGGGGTGAAAGG - Intergenic
932316301 2:70786237-70786259 TTTTTTTGGCAGGGGGTGCAGGG + Intronic
932731728 2:74226631-74226653 GAATTTTGGCAGTGGGAACTCGG + Intronic
933651926 2:84856474-84856496 GCTTTTTGGCAGAGGCAGCAGGG + Intronic
934055129 2:88244945-88244967 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
934557877 2:95296991-95297013 GAATGGGGGTAGAGGGTGCAGGG - Intergenic
934610424 2:95731426-95731448 GAATCATGGTAGAGGGTGAAAGG + Intergenic
935117356 2:100147664-100147686 GAATTTTGGCTGAGTGAACAGGG + Intergenic
935298362 2:101670579-101670601 GAATCGTGGCAGAAGGTGAAGGG + Intergenic
935324746 2:101925870-101925892 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
935529127 2:104211423-104211445 CAATTATGGCAGAAGGTGAAGGG + Intergenic
935747012 2:106197255-106197277 CAATCATGGCAGAGGGTGAAGGG - Intergenic
936492700 2:112986249-112986271 CAATCATGGCAGAGGGTGAAGGG - Intergenic
936618236 2:114070286-114070308 GAAGTTTGGGAGGGGGTTCAGGG + Intergenic
937004108 2:118495885-118495907 CAATTTAGGCAAAGGGTGAAGGG - Intergenic
938160680 2:128982202-128982224 GAATTTTGCCTGAGGATGAATGG + Intergenic
939091643 2:137786969-137786991 TACTTATGGCAGAGGGTGAAGGG + Intergenic
939681727 2:145143898-145143920 TAATTTTGGCAAAGGGTATAAGG - Intergenic
940245371 2:151609775-151609797 GAATTTTGGGAAAGGGGGAAGGG - Intronic
940614830 2:156037452-156037474 GAATTCTGGGAGAGGGTGGTCGG - Intergenic
941233497 2:162940756-162940778 AAATATTGGCAAAGGGTTCATGG - Intergenic
941560440 2:167036959-167036981 GAATCATGGCGGAGGGTGAAAGG - Intronic
942419855 2:175796473-175796495 CAATCATGGCAGAGGGTGAAAGG - Intergenic
943456904 2:188119948-188119970 CAATTATGGCAGAAGGTGAAGGG + Intergenic
944724227 2:202453662-202453684 GAATAGTGGCAGAGGGGGTAAGG + Intronic
946460903 2:219867912-219867934 CAATTGTGGCAGAAGGTGAAAGG - Intergenic
946562595 2:220929269-220929291 GAATGATGGCAGAAGGTGAAAGG + Intergenic
946574386 2:221058168-221058190 GAATTGTAGCAGAAGGTGAAAGG + Intergenic
946874692 2:224115618-224115640 CAATCGTGGCAGAAGGTGCAGGG - Intergenic
946992181 2:225346179-225346201 TAATTATGGCAGAAGGTGAAGGG - Intergenic
947466451 2:230352381-230352403 CAATTATGGTAGAGGGTGAAGGG + Intronic
948413404 2:237782524-237782546 GAAATGTGGCTGAAGGTGCAGGG - Intronic
948975464 2:241461031-241461053 GAAGTTTAGCAGAGCCTGCAGGG - Intronic
949058968 2:241945513-241945535 GGCTTGGGGCAGAGGGTGCAGGG + Intergenic
1169281425 20:4270435-4270457 GAATATTTGAAGAGGGTGGAGGG - Intergenic
1169991361 20:11506644-11506666 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1170301285 20:14887018-14887040 GATTTTTGGCAGAGGATGGGAGG + Intronic
1171303861 20:24088055-24088077 TAATTTTTGCAGAGGGTGTAAGG + Intergenic
1172200340 20:33121677-33121699 GAATCATGGCAGAAGGTGAAAGG - Intergenic
1172242173 20:33420517-33420539 GAAGTTAGGCAAAGGGTGCAGGG - Intronic
1173012954 20:39199171-39199193 GAAAAATGGCAGAGGGTGCATGG + Intergenic
1173088770 20:39950513-39950535 GAATTTTGTCTGAGGGAGAAAGG + Intergenic
1174321371 20:49744242-49744264 GAATGTTGGCAGATGGCACAGGG - Intergenic
1174688836 20:52482439-52482461 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1174886066 20:54335993-54336015 GACTTTTGGCAGAGTCTTCAGGG - Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1177302771 21:19271503-19271525 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1177557007 21:22703740-22703762 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1177674872 21:24284150-24284172 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1177767482 21:25474732-25474754 CAATTATGGCAGAGGGTGAAGGG - Intergenic
1178013956 21:28320498-28320520 GAATATGGACAAAGGGTGCATGG - Intergenic
1178216811 21:30607913-30607935 TAATTTTTGCATAAGGTGCAAGG - Intergenic
1178226414 21:30724643-30724665 CAATTTTGGCGGAGGGTACAAGG - Intergenic
1178842684 21:36150587-36150609 ATATTTTGGAAGAGGGTGCTGGG - Intergenic
1179193461 21:39143091-39143113 GAATCGTGGCAGAAGGTGAAGGG - Intergenic
1179194761 21:39154721-39154743 CAATCATGGCAGAAGGTGCAGGG + Intergenic
1181975633 22:26727375-26727397 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1182358327 22:29732798-29732820 GAATTTTGGCGGCGGCTGCATGG - Intronic
1183285034 22:36956730-36956752 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
949367133 3:3294602-3294624 GAATTTTGGCAGAGCCTTTAGGG - Intergenic
949482497 3:4507210-4507232 GAAGTTTTCCAGAGGCTGCAAGG - Intronic
950163615 3:10777791-10777813 GAATGTTAGCTGAGGTTGCAGGG + Intergenic
952246970 3:31605596-31605618 CAATCTTGGCAGAAGGTGAAAGG - Intronic
953203222 3:40796614-40796636 GAATATTGGCAGGGGGTGGAGGG - Intergenic
953678771 3:45024082-45024104 CAATTGTGGCAGAAGGTGAAGGG - Intronic
953772766 3:45791684-45791706 CAATTTTGGAAGAAGGTGAAGGG + Intronic
953789209 3:45934096-45934118 GAATTGGGGGACAGGGTGCAAGG + Intronic
955092033 3:55762020-55762042 AAATTATGGCAGAAGGTGAAGGG - Intronic
955546080 3:60031768-60031790 GAGGCTTAGCAGAGGGTGCATGG + Intronic
955673083 3:61422753-61422775 GGATTTTGGCCGAGATTGCATGG + Intergenic
956185537 3:66558971-66558993 GAATCATGGCAGAAGGTGAAAGG + Intergenic
956813118 3:72884183-72884205 GAATCATGGCAGAGGGTGAAAGG - Intergenic
957559001 3:81797429-81797451 TAATTTTGGTATAAGGTGCAAGG + Intergenic
957789975 3:84928398-84928420 CAATTATGGCAGAAGGTGAAGGG + Intergenic
957988298 3:87598228-87598250 GAATTATGGCAGGAGGTGAAAGG + Intergenic
958583796 3:96060638-96060660 GAATCATGGCAGAAGGTGAAGGG - Intergenic
958823079 3:98998563-98998585 CAATTATGGCAGAAGGTGAAAGG - Intergenic
958927883 3:100178965-100178987 GAAACTTGGCAGAAGGTGAAGGG + Intergenic
959041263 3:101425034-101425056 CAATTATGGCAGAAGGTGAAAGG - Intronic
959044663 3:101460152-101460174 GAATTTTGGTAGGGAGTGAATGG - Intronic
959832476 3:110880915-110880937 GAATTATGGCAGCAGGTGAAAGG - Intergenic
959862407 3:111230614-111230636 CAATTATGGCAGAAGGTGAAGGG - Intronic
961608815 3:128120093-128120115 GATTTTTGGCCCAGGGTACAGGG + Intronic
962859213 3:139382336-139382358 AAATTTTGGCAGCAGGTGAAGGG - Intronic
963521079 3:146360628-146360650 GAATCATGGCAGAAGGTGAAGGG - Intergenic
963547854 3:146684549-146684571 CAATCATGGCAGAGGGTGAAAGG + Intergenic
963683384 3:148409360-148409382 CAATCATGGCAGAGGGTGAAGGG + Intergenic
963687186 3:148451072-148451094 CAATTATGGCAGAAGGTGAAGGG - Intergenic
963816504 3:149837529-149837551 CAATCATGGCAGAGGGTGAAAGG + Intronic
964242775 3:154616143-154616165 GCATGTTTGCAGAGGGGGCAGGG - Intergenic
964255848 3:154773226-154773248 GAGTCTTGGCAGAGCGTGCTTGG - Intergenic
964856590 3:161152206-161152228 TAATCATGGCAGAGGGTGAAAGG + Intronic
964910903 3:161778245-161778267 GAATTATGGCAGGAGGTGAAAGG - Intergenic
965348255 3:167579097-167579119 CAATTATGGCAGAAGGTGAAGGG - Intronic
965441915 3:168724830-168724852 GAATTTTAGCAAAGATTGCATGG - Intergenic
965886721 3:173455222-173455244 CAATCATGGCAGAGGGTGAAGGG + Intronic
966052156 3:175632342-175632364 CAATCTTGGCAGAAGGTGAAGGG - Intronic
966663890 3:182448761-182448783 GAAGTTTTCCAGAGGCTGCATGG + Intergenic
967235287 3:187378120-187378142 GTATTATGGCAGAGGGTGAGAGG + Intergenic
967513790 3:190342315-190342337 CAATTATGGCAGAAGGTGAAAGG + Intronic
969041060 4:4296533-4296555 CAATCTTGGCAGAAGGTGAAAGG - Intronic
969490339 4:7495979-7496001 GAATGTGGGCCGAGGGTGGAAGG + Intronic
970119548 4:12737984-12738006 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
970528559 4:16958118-16958140 GAATCTTGGCTGAGGGCCCAGGG + Intergenic
970953308 4:21781283-21781305 AAATTATGGCAGAAGGTGAAAGG - Intronic
971942448 4:33233274-33233296 GAATTATGGCAGAAGGTAAAGGG - Intergenic
972244030 4:37225807-37225829 GGAATTAGGCAGAGGGTGGAAGG - Intergenic
974482425 4:62462913-62462935 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
974626075 4:64430227-64430249 CAATTATGGCAGAAGGTGAATGG - Intergenic
974834727 4:67234116-67234138 CAATCATGGCAGAAGGTGCAGGG - Intergenic
975492272 4:75002294-75002316 GATTTTTGCCAGGGGCTGCAGGG + Intronic
975776827 4:77796510-77796532 GAATCATGGCAGAAGGTGAAGGG - Intronic
976000614 4:80370094-80370116 CAATTATGGCAGAGGGTGAAAGG + Intronic
976154388 4:82126775-82126797 GAATAATGGCAGAAGGTGAAGGG - Intergenic
977093761 4:92713662-92713684 CAATTATGGCAGAAGGTGAAAGG + Intronic
977121746 4:93110466-93110488 AAATGTTGGGTGAGGGTGCACGG - Intronic
977930418 4:102743887-102743909 GAATCATGGCAGAGGCTGCTAGG - Intronic
978044107 4:104105813-104105835 CAATTATGGCAGAAGGTGAAGGG - Intergenic
978256104 4:106694454-106694476 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
978892611 4:113848145-113848167 CAATCATGGCAGAGGGTGAATGG + Intergenic
980711420 4:136573350-136573372 CAATTATGGCAGAAGGTGAAGGG - Intergenic
982391040 4:154864030-154864052 GAATCATGGCAGAAGGTGAAGGG + Intergenic
982607990 4:157538291-157538313 GAATCATGGCAGAAGGTGAATGG + Intergenic
982655615 4:158145507-158145529 GAATTTTAGCAAAGGGTTGAGGG - Intronic
982669451 4:158302607-158302629 GAATTTTGGCAGAGGCCTCAGGG - Intergenic
982760593 4:159278478-159278500 GAAATTTAGCAGTGGGTGGAAGG + Intronic
982829406 4:160042283-160042305 GAATCATGGCAGAAGGTGAAAGG + Intergenic
984314857 4:178115670-178115692 GAATTTTTGTAGAAAGTGCATGG - Intergenic
984577821 4:181472308-181472330 GTATTATGGCAGAAGGTGGAAGG + Intergenic
985124872 4:186683192-186683214 GGATTTTTGCAGGGTGTGCATGG - Intronic
985131172 4:186740234-186740256 GAATATAGGCAGAGAGTGGATGG - Intergenic
985178791 4:187233324-187233346 GAATCATGGCAGGGGGTGAAAGG - Intergenic
986014548 5:3746604-3746626 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
986124299 5:4870700-4870722 CAATTATGGCAGAAGGTGAAGGG - Intergenic
986567662 5:9131236-9131258 CAATTATGGCAGAAGGTGAAAGG + Intronic
986881195 5:12173653-12173675 GAATCATGGCAGAAGGTGAAGGG - Intergenic
987105004 5:14629977-14629999 CAATTATGGCAGAAGGTGAAAGG + Intergenic
987169479 5:15239482-15239504 CAATTATGGCAGAAGGTGAAGGG - Intergenic
987212123 5:15693761-15693783 GAAATTTGGCAGAGGGTGGTTGG + Intronic
987681645 5:21143721-21143743 CAATCATGGCAGAGGGTGAAGGG - Intergenic
988025363 5:25679745-25679767 CAATTATGGCAGAAGGTGAAAGG - Intergenic
988128968 5:27078956-27078978 GAATTATGGCAGGAGGTGAAAGG + Intronic
988219477 5:28324290-28324312 GAATCATGGCAGAAGGTGAATGG + Intergenic
988305648 5:29491143-29491165 GAATCATGGCAGAAGGTGAAAGG + Intergenic
988426702 5:31073363-31073385 GAATCATGGCAGAGGGTGAAAGG + Intergenic
988925246 5:35982998-35983020 CAATTGTGGCAGAAGGTGAAGGG - Intronic
989308294 5:39982282-39982304 TAATTGTGGCAGAAGGTGAAGGG - Intergenic
990171292 5:53052914-53052936 GAGTTTTGGGAGAGAGTGTAGGG - Intronic
990716894 5:58647302-58647324 CAATTATGGCAGAAGGTGAAGGG + Intronic
991285819 5:64974380-64974402 CAATCATGGCAGAGGGTGAAAGG + Intronic
991562834 5:67972611-67972633 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
992375141 5:76181543-76181565 CAATCTTGGCAGAAGGTGAAGGG + Intronic
992528781 5:77636751-77636773 GGATTTGGGCAAAGGGAGCAGGG - Intronic
992739645 5:79760516-79760538 GAATCATGGCAGAAGGTGAAGGG + Intronic
992745938 5:79820340-79820362 CAATCATGGCAGAGGGTGAAAGG - Intergenic
993068234 5:83127482-83127504 GAATCATGGCAGAAGGTGAAAGG - Intronic
993160371 5:84282579-84282601 AAATTTTTGCACAGGGTACAAGG - Intronic
993215742 5:85020934-85020956 CAATTATGGCAGAAGGTGAAAGG + Intergenic
993590008 5:89782759-89782781 TAATTTTGGTATAAGGTGCAAGG - Intergenic
994138746 5:96319093-96319115 TAATTATGGCAGAAGGTGAAGGG + Intergenic
994446988 5:99888555-99888577 CAATTATGGCAGAAGGTGAAGGG - Intergenic
994967300 5:106690636-106690658 CAATTATGGCAGAAGGTGAAAGG - Intergenic
995392258 5:111652495-111652517 CAATCATGGCAGAGGGTGAAAGG + Intergenic
995396045 5:111688357-111688379 GTATTTTGGAAGAGGATCCAAGG + Intronic
995671918 5:114614606-114614628 GGATTTTGACTGAGAGTGCATGG - Intergenic
995972630 5:117990905-117990927 GCATTTTAGCAGAGGCTACATGG + Intergenic
998538517 5:142956785-142956807 CAATTATGGCGGAGGGTGAAAGG + Intronic
998760576 5:145427774-145427796 GAATTTGGGCAGAAAGTTCAGGG + Intergenic
998808372 5:145940555-145940577 GAACTGTGGCAGAGAGGGCAAGG - Intronic
999805024 5:155073092-155073114 GAATGATGGCAGAAGGTGAAAGG + Intergenic
1000255813 5:159537253-159537275 GAATTCTGGAAGAGCGTGCCAGG + Intergenic
1001134267 5:169089552-169089574 GAGTGTAGGCAGAGAGTGCACGG - Intronic
1001873368 5:175178030-175178052 TAATTTTGGAAAAGGGTGCCAGG - Intergenic
1003008676 6:2405813-2405835 CAATCTTGGCAGAAGGTGAATGG + Intergenic
1003484554 6:6564345-6564367 GAATCATGGCAGAAGGTGAAGGG + Intergenic
1004021339 6:11778634-11778656 AAATCTTGGCAAATGGTGCAAGG - Exonic
1004039405 6:11960918-11960940 GAGTTTTGGCAGAGGCTCAAAGG - Intergenic
1004734840 6:18395043-18395065 GAATTTTGGCAGAGAATGCAAGG - Intronic
1004805575 6:19200825-19200847 GAATCATGGCAGAAGGTGAAAGG + Intergenic
1005445643 6:25919770-25919792 GAATTTTGGCACAAGGAACAGGG + Intronic
1006306422 6:33223255-33223277 GAATTTTGATAGAGGTTGGATGG - Intergenic
1006914454 6:37585368-37585390 GAATCCTGGCAGAGGAGGCAGGG - Intergenic
1007166665 6:39833090-39833112 GAATTTCAGAATAGGGTGCAGGG - Intronic
1007176461 6:39901171-39901193 GACTGTTGGCACAGGGGGCAGGG - Intronic
1008108562 6:47467349-47467371 GAAGGTTGGCAGAGTGTGCAGGG + Intergenic
1008755903 6:54795476-54795498 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1008848316 6:55994720-55994742 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1008870851 6:56270841-56270863 CAATTGTGGCAGAAGGTGAAGGG - Intronic
1009535175 6:64873163-64873185 CAATTATGGCAGAAGGTGAAAGG + Intronic
1009615006 6:65992491-65992513 GAATCATGGCAGAGGTTGAAAGG + Intergenic
1009715774 6:67393666-67393688 GAATCATGGCAGAAGGTGAAAGG - Intergenic
1009824195 6:68845696-68845718 CAATCATGGCAGAGGGTGAAAGG - Intronic
1010531878 6:76978427-76978449 CACTTATGGCAGAGGGTGAAGGG - Intergenic
1010909793 6:81539065-81539087 CAATTGTGGCAGAAGGTGAAGGG - Intronic
1011039857 6:83017613-83017635 GAAATTTGGGTGAGAGTGCAGGG + Intronic
1012098620 6:94999505-94999527 GAATCATGGCAGAAGGTGAAGGG - Intergenic
1012222984 6:96673486-96673508 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1012346397 6:98192833-98192855 TAAGGTTGGCAGGGGGTGCAGGG - Intergenic
1012477051 6:99625095-99625117 GAGTTGTGGGGGAGGGTGCAAGG + Intergenic
1013815235 6:114090043-114090065 TATCTTTGGCAGAGGGTTCATGG - Intronic
1013863287 6:114661506-114661528 GAATCATGGCAGGGGGTGAAAGG - Intergenic
1014082601 6:117304966-117304988 CAATCATGGCAGAGGGTGAAGGG - Intronic
1014288538 6:119531166-119531188 CAATTTTGGCAGAAGGTGAAGGG - Intergenic
1014691559 6:124569656-124569678 GAATCATGGCAGAGGGTGAAAGG - Intronic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1014863375 6:126497584-126497606 GAATCATGGCAGAAGGTGAAAGG + Intergenic
1014899218 6:126942942-126942964 TAATTTTTGAAGAGGCTGCATGG + Intergenic
1015706056 6:136088880-136088902 AAAATTTGGCAGGGGGTGGAGGG + Intronic
1015768278 6:136742477-136742499 TAATTTCTGCAGAGGGTGTAAGG - Intronic
1015777650 6:136831197-136831219 AAATTATGGCAGAAGGTGAAGGG + Intronic
1016232648 6:141825181-141825203 GATGTTTGCCAGAGGGTGGAGGG - Intergenic
1016460236 6:144274082-144274104 GAATCATGGCAGAAGGTGAAAGG + Intergenic
1016773158 6:147874738-147874760 GAATTTTGGGAGGGGCAGCATGG + Intergenic
1017467225 6:154705805-154705827 GAATTTTGGAAGTGTGTGCCTGG + Intergenic
1017522557 6:155214517-155214539 GAAATTTGGAAGAAGGTGCATGG - Intronic
1017751656 6:157494332-157494354 GAAGAGTGTCAGAGGGTGCAGGG - Intronic
1018087587 6:160317800-160317822 GAATTTTGGCAGGAATTGCATGG + Intergenic
1018133960 6:160760415-160760437 CAATATTGGCAGAAGGTGAAGGG + Intergenic
1018201175 6:161397031-161397053 TCATTTTGGCTGAGGCTGCAGGG - Intronic
1018433095 6:163738340-163738362 TTATTTTGCCAGAGGGAGCAAGG - Intergenic
1018484240 6:164224769-164224791 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1020287322 7:6694346-6694368 ATATTTTGGCAGTGGGTTCAGGG - Intronic
1020537728 7:9423336-9423358 GAATCATGGCAGAAGGTGAAAGG + Intergenic
1021448946 7:20763369-20763391 AAATTTTGGCAGCAGCTGCATGG + Intronic
1021598447 7:22341172-22341194 GAATCATGGCAGAAGGTGAAAGG + Intronic
1022249399 7:28592486-28592508 GGATTTTGGATGAGGGAGCAAGG + Intronic
1023179272 7:37465376-37465398 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1023235308 7:38080602-38080624 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1023388952 7:39688901-39688923 CAATTGTGGCAGAGGGTGAAGGG + Intronic
1024499442 7:50088251-50088273 TAATTTTTGCATATGGTGCAAGG - Intronic
1024814990 7:53257794-53257816 CAATCATGGCAGAGGGTGAAAGG - Intergenic
1026049047 7:66929739-66929761 TTAATTTGGCTGAGGGTGCAGGG + Intronic
1026920170 7:74149772-74149794 GAATTTTGGCAGAGAAAGAAGGG - Intergenic
1027798185 7:82719705-82719727 GAATTATGGCAGAAGCTGAAAGG + Intergenic
1028222991 7:88219072-88219094 GAGTGTTGGCAGAGTGTGCCCGG - Intronic
1028703653 7:93813146-93813168 GAATTTAGACAGAGGATGCTGGG - Intronic
1029294495 7:99528950-99528972 GAATGTTGGCTAAGGGTGAAGGG + Intronic
1030209385 7:106981286-106981308 CAATCATGGCAGAAGGTGCAGGG - Intergenic
1031214994 7:118879223-118879245 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1031215001 7:118879265-118879287 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1031429828 7:121653870-121653892 GAATTTTGACACAGGGGTCAAGG - Intergenic
1031677014 7:124623066-124623088 CAATTGTGGCAGAAGGTGAAGGG + Intergenic
1032264351 7:130360446-130360468 GAATGTACACAGAGGGTGCAGGG + Intronic
1032530407 7:132615286-132615308 GAGTGGTGGCAGAGGGAGCAGGG + Intronic
1032759354 7:134924955-134924977 CAATTATGGCAGAAGGTGAAGGG - Intronic
1033712177 7:143959145-143959167 GAATTTGTGGAGAGGATGCAGGG + Intergenic
1034687659 7:152987350-152987372 GAATCATGGCAGAAGGTGAAAGG + Intergenic
1035469777 7:159102350-159102372 AAATCATGGCAGAAGGTGCAAGG - Intronic
1035789736 8:2293347-2293369 AAAGGTTGGCAGAGGCTGCAAGG + Intergenic
1035803069 8:2428358-2428380 AAAGGTTGGCAGAGGCTGCAAGG - Intergenic
1037368149 8:18144766-18144788 GAAAGTGGGCAGAGGGTGCCAGG - Intergenic
1037722993 8:21460359-21460381 GAGATTTGGCAGAAGGGGCAGGG - Intergenic
1037747474 8:21658536-21658558 CAATTATGGCAGACGGTGAAGGG + Intergenic
1038370579 8:26985855-26985877 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1039072689 8:33660770-33660792 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1039420582 8:37434902-37434924 GAATCATGGCAGAAGGTGAAAGG - Intergenic
1040401329 8:47052504-47052526 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1041234640 8:55787839-55787861 CAATTATGGCAGAAGGTGAAAGG + Intronic
1043010766 8:74879300-74879322 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1043601215 8:81940636-81940658 CAATTCTAGCAGAGGGAGCATGG - Intergenic
1044161396 8:88920758-88920780 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
1044831275 8:96252098-96252120 CAATTATGGCAGAAGGTGAAAGG - Intronic
1044992310 8:97806993-97807015 GAATCATGGCAAAGGGTGAAAGG - Intronic
1046083929 8:109408240-109408262 GAATGATGTGAGAGGGTGCAGGG - Intronic
1046321445 8:112582252-112582274 CAATTGTGGCAGAAGGTGAAGGG - Intronic
1046735030 8:117767757-117767779 CAATCATGGCAGAAGGTGCAAGG - Intergenic
1047379542 8:124346105-124346127 AAATCGTGGCAGAGGGTGAAGGG + Intronic
1047622087 8:126618174-126618196 TAATTCTGGCATTGGGTGCAAGG + Intergenic
1047860408 8:128959749-128959771 GAATCATGGCAGAAGGTGAAGGG + Intergenic
1048117504 8:131541709-131541731 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1048532819 8:135265746-135265768 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1049412994 8:142481728-142481750 GCATTTTGGAAGAGGGTGTCGGG + Intronic
1050109708 9:2201728-2201750 CAATTATGGCAGATGGTGAAGGG + Intergenic
1050250361 9:3737179-3737201 GTCTTTTAGCAGAGGGTGGATGG + Intergenic
1050402604 9:5271791-5271813 CAATTATGGCAGAGGGTGAAAGG - Intergenic
1050481678 9:6094474-6094496 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1050540109 9:6662355-6662377 GAATTTAGGCATAGAGGGCAGGG - Intergenic
1050945284 9:11510025-11510047 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1051021880 9:12554912-12554934 GATTTTTGGCATAGGGCTCATGG - Intergenic
1051937801 9:22465670-22465692 GAATCCTGGCAGAAGGTGAAGGG - Intergenic
1052179126 9:25502905-25502927 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1052475237 9:28951215-28951237 TAATTTTTGCAGAAGGTGTAAGG - Intergenic
1052724050 9:32207730-32207752 CAATTATGGCACAGGGTGAAGGG - Intergenic
1053205068 9:36179268-36179290 GAATTATGGCAGAAGGTGAAAGG + Intergenic
1054341228 9:63863914-63863936 TAATCTTGGCAGAAGGTGAAGGG + Intergenic
1056005276 9:82263061-82263083 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1056420038 9:86415362-86415384 GAACCTGGGCAGAGGGTGTATGG + Intergenic
1056638512 9:88350566-88350588 GAATCATGGCAGAGGGTGAAAGG + Intergenic
1056734531 9:89196732-89196754 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1057316602 9:93972982-93973004 GAATCATGGCAGAAGGTGGAAGG + Intergenic
1057590114 9:96365425-96365447 GAACTGTGGCAGAGGGAGAAAGG + Intronic
1058004436 9:99900866-99900888 GAATTATGGCAGGAGGTGAAAGG + Intergenic
1058797497 9:108512769-108512791 GAATCATGGCAGTGGCTGCATGG + Intergenic
1060375111 9:123110330-123110352 GTACTTTGGCAGGGGGTGCTGGG - Intronic
1060702847 9:125774123-125774145 GAATCATGGCAGAAGGTGAAGGG + Intronic
1060980786 9:127790460-127790482 GAAAGTGGGCAGAGGGTGAAGGG + Exonic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1186116430 X:6309275-6309297 GAATCATGGCAGAAGGTGAAAGG - Intergenic
1186268509 X:7858797-7858819 CAATCATGGCAGAGGGTGAAGGG + Intergenic
1187488423 X:19726232-19726254 GGAGTTTGGCAGAGGCGGCATGG + Intronic
1188039160 X:25352013-25352035 CAATTATGGCGGAGGGTGAAGGG + Intergenic
1188365758 X:29312930-29312952 CAATTATGGCAGAAGGTGAAAGG - Intronic
1188674094 X:32917214-32917236 CAATCTTGGCAGAAGGTGAAGGG - Intronic
1188980819 X:36725402-36725424 GAAGCTTAGCAGAAGGTGCATGG + Intergenic
1189078863 X:37947476-37947498 CAATCATGGCAGAGGGTGAAGGG - Intronic
1189191227 X:39108279-39108301 GAATTTTTGTATATGGTGCAAGG + Intergenic
1189410494 X:40766154-40766176 CAATTGTGGCAGAAGGTGAAGGG - Intergenic
1189636316 X:43014103-43014125 GAATCATGGCAGAAGGTGAAAGG - Intergenic
1190566716 X:51737946-51737968 CAATTATGGCAGAAGGTGAAGGG - Intergenic
1190997128 X:55620725-55620747 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1191177637 X:57522261-57522283 TAATTTTTGTAGAAGGTGCAGGG + Intergenic
1192003276 X:67180389-67180411 GAATATTGACAGAGGCTGTATGG - Intergenic
1192038902 X:67596129-67596151 AAATTATGGCAGAAGGTGAAGGG - Intronic
1192670748 X:73138219-73138241 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1192993205 X:76484707-76484729 TAATTTTTGTATAGGGTGCAAGG + Intergenic
1193003985 X:76595740-76595762 GAATCATGGCAGGAGGTGCAAGG + Intergenic
1193140176 X:78018823-78018845 AAATCTTGGCAGAAGGTGAAGGG + Intronic
1194572044 X:95564420-95564442 GAATTTTGACTGAGATTGCATGG + Intergenic
1196583658 X:117404793-117404815 CAATTATGGCAGAAGGTGAAAGG + Intergenic
1197608835 X:128615979-128616001 GCATTTGGGCAGAGTGTGGAGGG + Intergenic
1198261944 X:134972897-134972919 CAATTATGGCAGAAGGTGAAAGG - Intergenic
1198848565 X:140940349-140940371 TAATTATGGCAGAAGGTGAAGGG - Intergenic
1199035445 X:143044691-143044713 TAATCATGGCAGAGGGTGAAAGG - Intergenic
1199440050 X:147857651-147857673 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1200660873 Y:5955957-5955979 CAATTATGGCAGAAGGTGAAGGG + Intergenic
1201469311 Y:14316538-14316560 GAATTATGGCAGGAGGTGAAAGG - Intergenic
1201848603 Y:18451427-18451449 CATTTTAGGCACAGGGTGCATGG + Intergenic
1201884714 Y:18868948-18868970 CATTTTAGGCACAGGGTGCATGG - Intergenic
1201927915 Y:19310344-19310366 CAATTATGGCAGAAGGTGAAAGG + Intergenic