ID: 921919451

View in Genome Browser
Species Human (GRCh38)
Location 1:220650078-220650100
Sequence GGCACTGCACACACCACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921919447_921919451 6 Left 921919447 1:220650049-220650071 CCTGAGACTCGAGGAAATATCTT 0: 1
1: 0
2: 0
3: 2
4: 121
Right 921919451 1:220650078-220650100 GGCACTGCACACACCACTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 168
921919445_921919451 20 Left 921919445 1:220650035-220650057 CCTTCTAGCTCAAACCTGAGACT 0: 1
1: 0
2: 2
3: 11
4: 88
Right 921919451 1:220650078-220650100 GGCACTGCACACACCACTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 168
921919444_921919451 24 Left 921919444 1:220650031-220650053 CCTGCCTTCTAGCTCAAACCTGA 0: 1
1: 0
2: 1
3: 11
4: 134
Right 921919451 1:220650078-220650100 GGCACTGCACACACCACTGTTGG 0: 1
1: 0
2: 0
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921919451 Original CRISPR GGCACTGCACACACCACTGT TGG Intronic