ID: 921919855

View in Genome Browser
Species Human (GRCh38)
Location 1:220655640-220655662
Sequence CAGAGTATGAAGGCAGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921919855_921919860 8 Left 921919855 1:220655640-220655662 CCCGCCACTGCCTTCATACTCTG 0: 1
1: 1
2: 1
3: 16
4: 288
Right 921919860 1:220655671-220655693 TTCATCTTTCACTTCCTCATAGG 0: 1
1: 0
2: 1
3: 37
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921919855 Original CRISPR CAGAGTATGAAGGCAGTGGC GGG (reversed) Intronic
900329619 1:2127504-2127526 CAGAGGCTGAGGGCAGTGGGAGG - Intronic
903280688 1:22248211-22248233 CAGACTAGGAAGGCAGGGCCAGG + Intergenic
904166759 1:28561586-28561608 CAGGGTAGGAAGCCAGGGGCAGG - Intronic
905699510 1:40000644-40000666 AAGAGTATGAATGCTGAGGCCGG + Intergenic
906542156 1:46595413-46595435 CAGAGGAAGGAGGCAGTGGGTGG - Intronic
907646779 1:56252313-56252335 CACAGAATGAAGGCAGTTGTGGG + Intergenic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
909779936 1:79531759-79531781 CAGAGACTGAAGGCAGAGGCAGG - Intergenic
910214034 1:84824212-84824234 AGGAGTATGAATGAAGTGGCAGG + Intronic
910791417 1:91054957-91054979 CAGAGTGAGAAGGCAGAGGTGGG + Intergenic
912241665 1:107916956-107916978 TAAAGTGTGAAGGCAGTGACTGG + Intronic
912951894 1:114126012-114126034 CACAGGATGAAGGCAGTGAGTGG + Intronic
915876013 1:159612837-159612859 CAAAGTCTGAAGGCGGTGTCAGG - Intergenic
917289896 1:173461174-173461196 CACAGTATGTAGGGGGTGGCTGG - Intergenic
918774525 1:188611034-188611056 GAGAGAAGGCAGGCAGTGGCAGG - Intergenic
919220043 1:194616612-194616634 GTGGGTATGAAGGCACTGGCTGG - Intergenic
921919855 1:220655640-220655662 CAGAGTATGAAGGCAGTGGCGGG - Intronic
922396468 1:225206530-225206552 CACACTATGAAGACAGTGGGAGG + Intronic
923801822 1:237217586-237217608 CAGAGTATCCAAGCAGTGTCTGG + Intronic
924606506 1:245540051-245540073 CAGAGTGTGAAGGCAGGGAAAGG - Intronic
1063679292 10:8171905-8171927 CAGGGCAGGAAGGCAGAGGCAGG - Intergenic
1063759076 10:9051765-9051787 CAAAGCATGGAGTCAGTGGCAGG - Intergenic
1066046603 10:31600821-31600843 CAGAGTGGGAAGGAAGAGGCTGG - Intergenic
1066473609 10:35723486-35723508 CCGAGGTTGAAGGCAGTGACTGG - Intergenic
1069118788 10:64541763-64541785 CAGAGTATAAAGGTGGTTGCTGG + Intergenic
1070840505 10:79484127-79484149 CAGAATATGAAGGCTGGGGGTGG + Intergenic
1071539058 10:86463280-86463302 GAGAGTTTCAAGGCAGTGGGGGG + Intronic
1072234209 10:93439070-93439092 CATAGCCTGAAGGCTGTGGCAGG + Intronic
1074115665 10:110456089-110456111 CAGACTGTGAGTGCAGTGGCTGG - Intergenic
1074592609 10:114827499-114827521 AAGAGTATCAAGGCATAGGCCGG + Intronic
1074621078 10:115123712-115123734 CACAGTAGGAAGTGAGTGGCGGG + Intronic
1075442475 10:122491116-122491138 AAAAGAATGAAGGCAGAGGCTGG - Intronic
1075542452 10:123326403-123326425 CACAATATGAAAGCAGAGGCAGG - Intergenic
1076168396 10:128300549-128300571 CAGAGCAAGAAGGTACTGGCAGG - Intergenic
1076572343 10:131440993-131441015 CAGAGCATTAGGTCAGTGGCGGG - Intergenic
1077322809 11:1949862-1949884 CAGGGTGTGCCGGCAGTGGCAGG + Intronic
1079083450 11:17429427-17429449 CAGGGCATGAAGGCAGAGCCTGG - Intronic
1079322575 11:19463808-19463830 CAGAGTGTGGGGGCAGGGGCTGG + Intronic
1080587678 11:33696382-33696404 CAGAGAATGAGAGCAGTAGCTGG - Intergenic
1080662788 11:34311057-34311079 CAGAAACTGAAGGCAGTGGAAGG - Intronic
1081848898 11:46261098-46261120 CAAATAATGAAGGCAGTGGGTGG - Intergenic
1083863802 11:65442444-65442466 CAGGCTATGAAGGAAATGGCTGG + Intergenic
1083932185 11:65852152-65852174 CAGGGGAGGGAGGCAGTGGCTGG - Intronic
1084231828 11:67759122-67759144 CAGAGTCTGAATGCAGTTGTTGG - Intergenic
1084598930 11:70133453-70133475 CAGAGGATGAAGGTAGAGCCGGG + Intronic
1085018904 11:73192710-73192732 CAGAGGAAGCAGGCACTGGCAGG - Intergenic
1085315135 11:75540254-75540276 CAGAGTAGGAAGGCACTAGCAGG - Intergenic
1085315937 11:75544998-75545020 CAGAGTCTAAAGGCAGTGTGTGG + Intergenic
1086251034 11:84814559-84814581 CAGAGTATGAAGGCTGTGGAGGG - Intronic
1087039944 11:93788825-93788847 CAGTTAATGAAGGCAGAGGCAGG - Intronic
1087660868 11:100986486-100986508 CAGAGTAGGAAGCCAGTTGAAGG + Intronic
1088547055 11:110969650-110969672 AAGAGAATGAAGGAATTGGCAGG - Intergenic
1088994162 11:114981991-114982013 CACACTATGAAGGCATTTGCTGG + Intergenic
1089183378 11:116598175-116598197 CACAGAATGAATGCACTGGCAGG + Intergenic
1089402475 11:118172244-118172266 TAGAGTATGTAGACAGTGCCTGG - Intronic
1089776459 11:120840233-120840255 CAGAGGAGGAAGTCAGTGACAGG + Intronic
1091134697 11:133178332-133178354 CAGAGTAGGGAGCCTGTGGCTGG - Intronic
1202805827 11_KI270721v1_random:5175-5197 CAGGGTGTGCCGGCAGTGGCAGG + Intergenic
1092726193 12:11487920-11487942 CAGAGTGAAAAGGCAGAGGCAGG - Intronic
1092726737 12:11493963-11493985 CAGAGCAGGGAGGGAGTGGCAGG - Intronic
1093127489 12:15348307-15348329 CAAGGTATGCAGGCAGTGGAAGG + Intronic
1096539827 12:52300731-52300753 CAGGGGATGATGGCAGGGGCTGG + Intronic
1098976763 12:76910550-76910572 CAGAGAGTGAAGGCATTGGAAGG - Intergenic
1100542309 12:95568926-95568948 AAGAAAATGGAGGCAGTGGCCGG - Intergenic
1102216062 12:111162221-111162243 CAGTGGAGGAAGGCAGGGGCTGG - Intronic
1103176029 12:118864091-118864113 CACACTATGAATGCAGTGTCTGG - Intergenic
1104732086 12:131112883-131112905 CATAGTATGCAGGGTGTGGCAGG - Intronic
1105352069 13:19624953-19624975 CAGAGTCTCAAGGCAGTGCAAGG + Intergenic
1105844605 13:24283200-24283222 GAGAGTCTGAAGCAAGTGGCAGG - Intronic
1106288858 13:28342293-28342315 CAGACTTTGAAGGCTGTAGCTGG - Intronic
1107737401 13:43414630-43414652 CAGAGTAGCAAGGCAGAGTCAGG + Intronic
1108294738 13:49002571-49002593 CAAAGCATGAAGGCAGTTCCTGG - Intronic
1108435765 13:50400300-50400322 CATAGTATGAAAGTAGGGGCAGG - Intronic
1108597300 13:51960552-51960574 CAGTATGTGAAGGCAGGGGCTGG - Intronic
1109689010 13:65861642-65861664 TAGAGTATGTAGGCAGTAGTTGG - Intergenic
1111653111 13:91117520-91117542 CAGACAATAAAGCCAGTGGCTGG + Intergenic
1112798800 13:103087932-103087954 CAGAAGATGAAGCAAGTGGCTGG + Intergenic
1112995332 13:105567823-105567845 CAGAGAATGAAGGCAGAGATGGG + Intergenic
1113304634 13:109064328-109064350 CAGAGTTTGGATGCAGAGGCAGG - Intronic
1113799585 13:113079412-113079434 CAAAGTGTGAAGCCAGTGGCGGG - Intronic
1114718265 14:24851795-24851817 CAGAGATTGAAGGCAGAGGTGGG - Intronic
1115742924 14:36406946-36406968 CAGAGGTTGCAGGCAGTGGAAGG + Intergenic
1116919269 14:50555578-50555600 CAAAATATGAAGGAACTGGCTGG - Intronic
1117968398 14:61228935-61228957 TAGAGTATTGGGGCAGTGGCTGG + Intronic
1118795779 14:69142279-69142301 CAGAGCATGAATAAAGTGGCAGG + Intronic
1121791959 14:96705400-96705422 CTGAGTGCGAAGGCAGTGGGTGG + Intergenic
1121811377 14:96894134-96894156 CAGAGGATGGAGGCAGAAGCGGG + Intronic
1122113093 14:99515138-99515160 CAGAGGAAGAAGACAGGGGCTGG + Exonic
1122699523 14:103578500-103578522 CAGAGTGTTTATGCAGTGGCAGG + Intronic
1125766278 15:42138623-42138645 CTGAGTATGAGGACAGAGGCTGG - Intergenic
1127054405 15:55116778-55116800 CAGAGTTTTCATGCAGTGGCAGG + Intergenic
1127366360 15:58294260-58294282 CAGAGTCTTAGGGCAGTGGAAGG + Intronic
1128330367 15:66751621-66751643 CAAAGTGTGAAGCCAGTGGTGGG + Intronic
1128764666 15:70243859-70243881 CAAAGCAAGAGGGCAGTGGCGGG + Intergenic
1129111673 15:73340686-73340708 GAGAGTGGGAGGGCAGTGGCAGG - Intronic
1129518648 15:76171937-76171959 CAGAGGATGACGACAGAGGCAGG + Intronic
1130219639 15:82008454-82008476 TAGAATATGAAGGCAGAGGCTGG + Intergenic
1132543209 16:521066-521088 CAGAGGATGAGGGTTGTGGCAGG + Exonic
1135801133 16:25497357-25497379 CAAAGTATGCAGACAGTGTCAGG - Intergenic
1135827707 16:25744613-25744635 CAGAATGTAAATGCAGTGGCTGG - Intronic
1135933221 16:26757179-26757201 GAAAGTGTGAAGGGAGTGGCTGG + Intergenic
1138813110 16:60173849-60173871 ACGAATATCAAGGCAGTGGCAGG - Intergenic
1144003572 17:11078232-11078254 CAGTGTATGGAGGGAGTGGATGG + Intergenic
1144300823 17:13921981-13922003 CACAGGATGCAGGGAGTGGCAGG - Intergenic
1145902028 17:28495715-28495737 GAGAGGATGATGGCAATGGCTGG - Exonic
1147012998 17:37466760-37466782 CAGAGAATGAAGGAAGAGCCTGG - Intronic
1149362835 17:55911898-55911920 CATAAAATGAGGGCAGTGGCAGG - Intergenic
1149665416 17:58361732-58361754 AACAGCATGAAGGCTGTGGCTGG - Intronic
1151234573 17:72710189-72710211 CAGAGTAGAAAGTCACTGGCAGG - Intronic
1152127978 17:78458858-78458880 AAGAGGATGCAGGCAGAGGCAGG - Intronic
1152235474 17:79136222-79136244 CAGTGGATGAAGGCAGTGTGGGG - Intronic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1152505642 17:80747971-80747993 CAGTGTTTGGAGGCCGTGGCGGG + Intronic
1153677617 18:7469399-7469421 CAGAGCAGGGAGGCATTGGCTGG - Intergenic
1154012652 18:10589108-10589130 CAAAGTATCAAGGACGTGGCTGG - Intergenic
1156041229 18:32825234-32825256 CAGAGTATCCAGGAAGTGGCTGG - Intergenic
1159007520 18:63025772-63025794 CACAGCATGAAGTCATTGGCAGG - Intergenic
1159133869 18:64312671-64312693 GAGAGATTGAAGGCATTGGCTGG - Intergenic
1159269211 18:66127444-66127466 GAGAATATGGAAGCAGTGGCTGG + Intergenic
1159605859 18:70474152-70474174 CCCAGAATGCAGGCAGTGGCTGG - Intergenic
1160097423 18:75887854-75887876 CAGAGCAGGAAGCCAGTGGAAGG - Intergenic
1160346501 18:78136680-78136702 TAGAGCAAGAAGGCAGTGGAAGG + Intergenic
1161282544 19:3453791-3453813 CTGAGCAGAAAGGCAGTGGCTGG - Exonic
1162934117 19:13972698-13972720 CAGAGGAGGCAGGCAGTGGTGGG - Intronic
1163057338 19:14730349-14730371 CTGAAAATGAAGACAGTGGCCGG - Intronic
1163329871 19:16629078-16629100 CAGAATCTCAAGGCAGAGGCGGG - Intronic
1165168660 19:33875154-33875176 CAGAGAAAGAAGGCCGAGGCAGG - Intergenic
1165890405 19:39108782-39108804 CAGAGCATCTAGGCAGTGCCTGG - Intronic
1167746591 19:51354467-51354489 TAGAGTTTGTAGGCAGGGGCAGG + Exonic
1168288360 19:55345517-55345539 CACACTCAGAAGGCAGTGGCCGG + Intronic
1168598311 19:57696641-57696663 CAGAGCATGAAGGCAGAGGGAGG + Intronic
925222520 2:2153528-2153550 AAGAGGAGGAAGGCAGAGGCTGG + Intronic
925276859 2:2656287-2656309 CAGACAATGAAGACGGTGGCAGG + Intergenic
925307463 2:2859333-2859355 CAGAGCACGCAGGCAGAGGCTGG + Intergenic
926374734 2:12215199-12215221 CACAGTAGGAAGTGAGTGGCAGG + Intergenic
926921915 2:17947286-17947308 CAGACTATGCAGGCACTGGTGGG + Intronic
928443929 2:31316348-31316370 CAGAGCATGCAGGCACTTGCAGG - Intergenic
930140348 2:47945163-47945185 CAGAGTAGGAAGGGTGTGGAAGG - Intergenic
930245969 2:48983773-48983795 CAGAGAATGTGGGCTGTGGCAGG + Intronic
933607979 2:84404036-84404058 CAGAATATTTAGGCAGAGGCTGG + Intergenic
935134908 2:100291513-100291535 AAGGAGATGAAGGCAGTGGCCGG - Intronic
937908538 2:127064422-127064444 GAGAGCCAGAAGGCAGTGGCAGG - Intronic
938881154 2:135590778-135590800 TAGAGTATGAAGGCAGATGATGG + Intronic
939270032 2:139927561-139927583 CAGAGTTGGATGGCAGTGGTTGG + Intergenic
940179351 2:150914618-150914640 CAGATGATGAAGGCAGAGACTGG - Intergenic
941912608 2:170779264-170779286 CAGACTATGAAGCCAGCAGCAGG - Intergenic
942326459 2:174780692-174780714 CAGGGTAGGAGGGCAGAGGCTGG + Intergenic
942420429 2:175801538-175801560 CAGAGCAGGAGGGGAGTGGCGGG - Intergenic
943087299 2:183328135-183328157 CAGAGGCTGAAGGTGGTGGCGGG - Intergenic
943544424 2:189256922-189256944 AAAAGTATGAGGACAGTGGCTGG - Intergenic
943661477 2:190563866-190563888 CAGAGTAGGGAGGCCTTGGCAGG - Intergenic
944470276 2:200045620-200045642 TAGCCTATGAAGGCAGTTGCAGG - Intergenic
944777259 2:202979347-202979369 CAGAGTATGATGATAGTGGTGGG + Intronic
944831973 2:203542020-203542042 AAGAAAATGAAGGCTGTGGCTGG + Intergenic
945159425 2:206874047-206874069 CAGAGCATGGAGGCAGAGTCAGG - Intergenic
945519008 2:210799860-210799882 CAGAGTAAGAATGCAGTGAGAGG - Intergenic
946130952 2:217606535-217606557 TTGAGTATGGAGGCAGTGGGTGG + Intronic
946894617 2:224310643-224310665 CAGAGCATGAAGGTCCTGGCAGG - Intergenic
947937005 2:234015492-234015514 CAGTGTATGAGGTCAGTGCCAGG - Intronic
948072282 2:235137670-235137692 CAGATTCTCAAGGCAGTGGGTGG - Intergenic
948625299 2:239264832-239264854 CCGAGTAGGAAGGAAGGGGCAGG - Intronic
1169005023 20:2199609-2199631 TAGAGGATGAAGGCAGAGACAGG + Intergenic
1169804368 20:9544206-9544228 CAGAGTAGATAGGCTGTGGCAGG - Intronic
1172659887 20:36560446-36560468 CAGAGCTGGAATGCAGTGGCGGG - Intergenic
1173744631 20:45426856-45426878 CAGAAGATGAGGGCAGTGGGAGG - Intergenic
1173803264 20:45908196-45908218 CAGAGTAGGAATGCAGAGGGCGG - Intronic
1174339762 20:49888315-49888337 GGCAGCATGAAGGCAGTGGCTGG - Exonic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174623443 20:51894824-51894846 CAGGGCAGGAAGGGAGTGGCAGG - Intergenic
1175545783 20:59776850-59776872 CAGAGAAGGAAGGCACTGGGCGG - Intronic
1178712862 21:34934804-34934826 AAGAGGATGAAGGCAGGGGTGGG + Intronic
1179625925 21:42649764-42649786 CAGAGAGTGGAGGCAGAGGCTGG + Intergenic
1179644397 21:42766837-42766859 CAGAGGAGGAAGGCATCGGCGGG - Intronic
1179781049 21:43701257-43701279 CCGAGTATCCAGGCAGTGCCAGG + Intergenic
1180005933 21:45020557-45020579 AAGAGAAGGCAGGCAGTGGCTGG - Intergenic
1181745876 22:24954475-24954497 CAGAGTTTCAATGCAGTGTCTGG + Intronic
1182016028 22:27040473-27040495 CACAGTATGAAGGCAGCAGCAGG + Intergenic
1182549977 22:31095654-31095676 CAGAGTATGAGGGGAGCAGCTGG - Intronic
1182863663 22:33583288-33583310 CACAGGATGAAGGCAGTGCATGG + Intronic
1183391922 22:37550243-37550265 CTGAGTTCAAAGGCAGTGGCTGG + Intergenic
949247220 3:1939483-1939505 CAGGGTATGATGGCTGGGGCTGG - Intergenic
949925600 3:9038614-9038636 CTGGGAATGAAGGCAGAGGCAGG - Intronic
950849105 3:16045161-16045183 CAGGTGAAGAAGGCAGTGGCTGG + Intergenic
951062579 3:18226897-18226919 CAAAGTATGATGGAATTGGCTGG + Intronic
951575423 3:24108452-24108474 CAGAGTAACAAGGAAATGGCAGG - Intergenic
951989081 3:28655795-28655817 CAGAGTAGGAAGACAGAGTCAGG - Intergenic
955483077 3:59408918-59408940 CAGAGTAGGAATGCAGAGACTGG - Intergenic
956332267 3:68124689-68124711 CAGAGAAGGAAACCAGTGGCTGG + Intronic
956648396 3:71479869-71479891 CAGATGATGAAAGCAGTGGTAGG - Intronic
958624737 3:96609658-96609680 CAGTGTCTGAAGGCAGCAGCAGG + Intergenic
958683499 3:97361595-97361617 CAGAGTATCAAGGTAGTGCAGGG + Intronic
959182996 3:103006231-103006253 CAGACTATTAGTGCAGTGGCTGG + Intergenic
962522660 3:136211605-136211627 TAGAGTATGAAGACAGAGCCTGG - Intergenic
962954010 3:140247692-140247714 CAGAGTGTGAGGGCAGTGTGGGG + Intronic
963074836 3:141336213-141336235 CAAAGTACAAAGGCACTGGCTGG + Intronic
963230144 3:142901278-142901300 TAGAGTTTCAAGACAGTGGCCGG + Intergenic
965005540 3:163018738-163018760 GCCAGTATGAAGGCAGCGGCAGG - Intergenic
966200260 3:177354447-177354469 CAGAGTAATGAGGCAGTAGCTGG + Intergenic
967320542 3:188190646-188190668 CAGAGTATGACAGCAGTAGAAGG + Intronic
968186061 3:196634274-196634296 CAGAGGCTGAAGGCAGTGCGGGG - Intergenic
968511210 4:996743-996765 CTGAGCATTGAGGCAGTGGCTGG + Intronic
969086074 4:4657482-4657504 CACAGTAGGAAGGGAGTGACAGG + Intergenic
969131020 4:4991147-4991169 CAGGGTGTCAAGCCAGTGGCAGG - Intergenic
969220421 4:5755256-5755278 CAGAGTGTGGAGACAGTGCCTGG + Intronic
969651214 4:8469378-8469400 CAGAGGAAGAAGGCTGAGGCTGG + Intronic
969941448 4:10736115-10736137 CACAATATTAAGGCAATGGCTGG - Intergenic
970036225 4:11738634-11738656 CAGACCATGAAGGCAGCTGCAGG + Intergenic
971646310 4:29209123-29209145 CAGAGTATGAAAGAAGTGATGGG + Intergenic
973282658 4:48376155-48376177 TAGAATATGAAGGAAGGGGCTGG + Intronic
975458249 4:74618774-74618796 CTGAGCATGGGGGCAGTGGCAGG - Intergenic
976860924 4:89665345-89665367 CAAAGTATGAAGTCTGTAGCTGG + Intergenic
977435688 4:96991329-96991351 CAATGTTTGAAGGCTGTGGCAGG + Intergenic
977593784 4:98855389-98855411 CAGAGAATGAAGGCAGTGGCTGG + Intergenic
978191282 4:105915360-105915382 CACAGTGTTAGGGCAGTGGCGGG + Intronic
978980144 4:114934617-114934639 GAGAGTAGGATGCCAGTGGCTGG + Intronic
984058809 4:174965694-174965716 CACAGAAAGAAGGCAGTGGTAGG - Intronic
984745233 4:183209068-183209090 TAGAGTCTGAAGGCTGTGGAAGG + Intronic
984966724 4:185145812-185145834 CAGAGTGTGACGGCAGTCGCAGG + Exonic
985956216 5:3268139-3268161 CAGATCATGAAGGCAGAGGAAGG - Intergenic
986563584 5:9087989-9088011 CAAAATATGAAGACAGTGGCCGG + Intronic
988016176 5:25563126-25563148 CAGCCCATGAAAGCAGTGGCAGG - Intergenic
988781576 5:34527349-34527371 CAGAGTGTGAGGCCAGTGGTGGG - Intergenic
995957331 5:117793821-117793843 CAGAGTATGAAGGGTGAGGGAGG - Intergenic
997160604 5:131605603-131605625 CAGAGTGGGAAGGCAGTGTTTGG - Intronic
997285074 5:132672257-132672279 CAGAGTATGGGGGCAGGGGGTGG + Intergenic
997327812 5:133036534-133036556 CAGAGAAAGAAGGCTGAGGCAGG + Intergenic
999621450 5:153478973-153478995 CAGGGCATGAGGGCAGTGGAGGG - Intergenic
1000257700 5:159556420-159556442 CAGATTCTGGAGGCAGTGGCTGG + Intergenic
1000978598 5:167792353-167792375 CTGAGGATGAAGGCAGAGACTGG + Intronic
1001756053 5:174170978-174171000 CAGAGCAGGAAGTGAGTGGCAGG - Intronic
1001840915 5:174875961-174875983 CTGGGAATGAAGCCAGTGGCTGG + Intergenic
1002103023 5:176866642-176866664 GAGAGGATGAAGGGAGTGGAGGG + Intronic
1002177771 5:177411378-177411400 CAGAATATGACAGAAGTGGCTGG + Intronic
1002548507 5:179969329-179969351 CAGAGAAGGCAGGCAGTGACTGG - Intronic
1003270679 6:4605261-4605283 CTGATTGTGAAGGCAGAGGCTGG + Intergenic
1003695217 6:8398986-8399008 CTGAGAAGGAAGGCAGTGTCAGG + Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005492989 6:26363962-26363984 CAGAGAATGAAGTCAGAAGCAGG - Intergenic
1005502264 6:26439286-26439308 CAGAGAATGAAGTCAGAAGCAGG - Intergenic
1006519521 6:34563277-34563299 CAGAGGCAGAAGGCAGCGGCTGG - Intergenic
1006592985 6:35171753-35171775 TACAATGTGAAGGCAGTGGCAGG - Intergenic
1007975662 6:46098796-46098818 AAGAGTCTGAGGGCAGTGGAGGG + Intergenic
1009409476 6:63349285-63349307 GAGAGTATTAAGGCAGAGACTGG + Intergenic
1011650992 6:89506022-89506044 TAGAGTAGGAAGGTAGTTGCGGG + Intronic
1011969903 6:93210171-93210193 CAGAGTGTGAAGAAAGTGGCAGG + Intergenic
1012377111 6:98575312-98575334 CAGACTAGGGAGGCAGAGGCAGG - Intergenic
1012617324 6:101293147-101293169 CAGCCTGTGAAAGCAGTGGCAGG - Intergenic
1014517912 6:122401460-122401482 CAGAGTATCATGTCAGTGGTAGG + Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG + Intergenic
1017547814 6:155470253-155470275 CAGAGCATGGAGGCAGAGACTGG - Intergenic
1018759829 6:166884310-166884332 CAGGGTATGGAGGAAGGGGCAGG - Intronic
1019875717 7:3808751-3808773 CAGAGAGTGATGGCACTGGCGGG + Intronic
1020636735 7:10705001-10705023 CAGAGTATGTAGGGAGAGGAAGG - Intergenic
1021475635 7:21057722-21057744 CAGAGTGTGCAGGCAGTTGCAGG - Intergenic
1021574424 7:22094269-22094291 GAGAGAGGGAAGGCAGTGGCAGG + Intergenic
1023644685 7:42297859-42297881 CAGAGTGTGGAGGAAGTGGGTGG - Intergenic
1024467315 7:49725298-49725320 CAGAGTACTAAGGTAGTGGAGGG - Intergenic
1026260679 7:68752734-68752756 CAGTGTGTGAAGTCAGGGGCAGG - Intergenic
1026977007 7:74505179-74505201 CAGAAAATGAAGGCAGAGGCCGG - Intronic
1027333886 7:77127454-77127476 AAGATAATGATGGCAGTGGCTGG - Intronic
1029781904 7:102743860-102743882 AAGATAATGATGGCAGTGGCTGG + Intergenic
1029945636 7:104529805-104529827 CAGAGGATGGAGGCACTGGGTGG + Intronic
1031688781 7:124764453-124764475 CAGAGTGTGAAGACAGTCCCCGG - Exonic
1034605765 7:152312437-152312459 CAGAGTGTGAAAACAGAGGCAGG + Intronic
1035154096 7:156898170-156898192 CACAGTACAAAGGCAGTGGGGGG - Intergenic
1035993336 8:4516553-4516575 CAGAGGCTTACGGCAGTGGCTGG - Intronic
1036477322 8:9104943-9104965 CAGAGTATGAAAGCTTTAGCAGG + Intronic
1036811388 8:11869298-11869320 GACAGTAAGAAGGCAGTAGCCGG + Intronic
1037545965 8:19922774-19922796 CAGAGAAAGAAAGCAGAGGCCGG + Intronic
1038200729 8:25410386-25410408 CAGATGATGAAGGTAGAGGCAGG + Intronic
1041317804 8:56582420-56582442 CTCAGTATGAAGGCAGCAGCTGG + Intergenic
1041928272 8:63260308-63260330 CACAGTAGGAAGTGAGTGGCAGG + Intergenic
1043204585 8:77421184-77421206 CATAGTATTGAGGCAGAGGCAGG + Intergenic
1044112275 8:88289938-88289960 CAGAGGATGGAGGCAGTAGGGGG - Intronic
1044532563 8:93324334-93324356 CAGAGGATGCAGGCAGTAGAGGG - Intergenic
1044710808 8:95055921-95055943 CTAAAAATGAAGGCAGTGGCAGG - Intronic
1046023748 8:108697698-108697720 CATAGTAAGAAGGAATTGGCTGG - Intronic
1046769537 8:118104493-118104515 CAGAGTATGAAGGAAGCGCTAGG + Intronic
1047172094 8:122503581-122503603 CAGAGGTAGAAGGCAGGGGCTGG - Intergenic
1049023228 8:139971537-139971559 CAAGGTATGAAGGCAGGGGCAGG - Intronic
1049360095 8:142208367-142208389 AGCAGCATGAAGGCAGTGGCTGG + Intergenic
1049853798 8:144849197-144849219 CAGAGAATGCAGGAAGTGGCTGG + Intronic
1050375940 9:4973073-4973095 CAGAGTTTGGAGGCAGTAGAAGG - Intergenic
1058729491 9:107836254-107836276 AAGATAATGAAGGCAGTGCCAGG - Intergenic
1059498137 9:114727214-114727236 CAGTGTGTGAAGGCTGAGGCTGG - Intergenic
1060803194 9:126557525-126557547 GAGAGTATTAAGCCAGGGGCAGG - Intergenic
1060896753 9:127223847-127223869 CAGATTTGGAAGGCACTGGCTGG - Intergenic
1061051943 9:128201972-128201994 CAGAGCAAGAAAGCAGGGGCGGG - Intronic
1061391057 9:130317202-130317224 CACAGCTTGAAGCCAGTGGCAGG - Intronic
1061955603 9:133959793-133959815 GAGAAGATGAAGGCAGAGGCTGG + Intronic
1062436107 9:136547182-136547204 CAGAGCATGGTGGCAGAGGCAGG + Intergenic
1186582954 X:10840617-10840639 AAGAGAAGGAAGGCGGTGGCTGG - Intergenic
1186997917 X:15143374-15143396 CAGAATAAGAAGGCAGTGAGGGG - Intergenic
1188012871 X:25075958-25075980 CAAAGTATGAAGGTTCTGGCCGG - Intergenic
1188445488 X:30249609-30249631 CAGAGGCTGAAAGCTGTGGCTGG - Intronic
1189704815 X:43749397-43749419 CAGAGTTTGAAGGCAAAAGCAGG + Intergenic
1189713808 X:43844110-43844132 CTGAGAATGAAGTCAGTGACTGG - Intronic
1190745578 X:53320329-53320351 TAGAGTAAGAAGCCAGTGTCTGG - Intronic
1191868523 X:65725601-65725623 CAGAGGATGAAGGTAGTGGGTGG - Intronic
1192142698 X:68659314-68659336 CAGGGAATGAAGGGAATGGCAGG - Intronic
1195683235 X:107564226-107564248 CAGTGTATGAAGGAGGTGGGAGG - Intronic
1197290310 X:124648315-124648337 CTGAGAATGAATCCAGTGGCTGG + Intronic
1199188254 X:144940552-144940574 CTCACTATGATGGCAGTGGCAGG - Intergenic
1200008487 X:153103828-153103850 CAGAACAAGAAGGCAGTGGTTGG - Intergenic
1200092135 X:153640993-153641015 CAGAGCAGGAAGACAGTTGCAGG + Intergenic
1200212076 X:154351215-154351237 CAGAGTGTGGGGGCAGGGGCGGG - Intronic