ID: 921925012

View in Genome Browser
Species Human (GRCh38)
Location 1:220704076-220704098
Sequence GCTCCTGGTGGGGTGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921925012_921925025 22 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925025 1:220704121-220704143 AGGGTTGACCCGACTTGCAATGG No data
921925012_921925021 2 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data
921925012_921925027 27 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925027 1:220704126-220704148 TGACCCGACTTGCAATGGGATGG No data
921925012_921925026 23 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data
921925012_921925022 3 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925022 1:220704102-220704124 GAAACTAGAATGGCCCTTCAGGG No data
921925012_921925019 -7 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925019 1:220704092-220704114 CAGGAGCTCCGAAACTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921925012 Original CRISPR GCTCCTGGTGGGGTGGGCTG AGG (reversed) Intergenic
No off target data available for this crispr