ID: 921925019

View in Genome Browser
Species Human (GRCh38)
Location 1:220704092-220704114
Sequence CAGGAGCTCCGAAACTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921925010_921925019 3 Left 921925010 1:220704066-220704088 CCAGCAAAGGCCTCAGCCCACCC No data
Right 921925019 1:220704092-220704114 CAGGAGCTCCGAAACTAGAATGG No data
921925009_921925019 4 Left 921925009 1:220704065-220704087 CCCAGCAAAGGCCTCAGCCCACC No data
Right 921925019 1:220704092-220704114 CAGGAGCTCCGAAACTAGAATGG No data
921925012_921925019 -7 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925019 1:220704092-220704114 CAGGAGCTCCGAAACTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921925019 Original CRISPR CAGGAGCTCCGAAACTAGAA TGG Intergenic