ID: 921925021

View in Genome Browser
Species Human (GRCh38)
Location 1:220704101-220704123
Sequence CGAAACTAGAATGGCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921925012_921925021 2 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data
921925010_921925021 12 Left 921925010 1:220704066-220704088 CCAGCAAAGGCCTCAGCCCACCC No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data
921925014_921925021 -5 Left 921925014 1:220704083-220704105 CCACCCCACCAGGAGCTCCGAAA No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data
921925015_921925021 -8 Left 921925015 1:220704086-220704108 CCCCACCAGGAGCTCCGAAACTA No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data
921925013_921925021 -4 Left 921925013 1:220704082-220704104 CCCACCCCACCAGGAGCTCCGAA No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data
921925017_921925021 -10 Left 921925017 1:220704088-220704110 CCACCAGGAGCTCCGAAACTAGA No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data
921925016_921925021 -9 Left 921925016 1:220704087-220704109 CCCACCAGGAGCTCCGAAACTAG No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data
921925009_921925021 13 Left 921925009 1:220704065-220704087 CCCAGCAAAGGCCTCAGCCCACC No data
Right 921925021 1:220704101-220704123 CGAAACTAGAATGGCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921925021 Original CRISPR CGAAACTAGAATGGCCCTTC AGG Intergenic