ID: 921925026

View in Genome Browser
Species Human (GRCh38)
Location 1:220704122-220704144
Sequence GGGTTGACCCGACTTGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921925013_921925026 17 Left 921925013 1:220704082-220704104 CCCACCCCACCAGGAGCTCCGAA No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data
921925020_921925026 -1 Left 921925020 1:220704100-220704122 CCGAAACTAGAATGGCCCTTCAG No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data
921925015_921925026 13 Left 921925015 1:220704086-220704108 CCCCACCAGGAGCTCCGAAACTA No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data
921925018_921925026 8 Left 921925018 1:220704091-220704113 CCAGGAGCTCCGAAACTAGAATG No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data
921925014_921925026 16 Left 921925014 1:220704083-220704105 CCACCCCACCAGGAGCTCCGAAA No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data
921925016_921925026 12 Left 921925016 1:220704087-220704109 CCCACCAGGAGCTCCGAAACTAG No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data
921925017_921925026 11 Left 921925017 1:220704088-220704110 CCACCAGGAGCTCCGAAACTAGA No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data
921925012_921925026 23 Left 921925012 1:220704076-220704098 CCTCAGCCCACCCCACCAGGAGC No data
Right 921925026 1:220704122-220704144 GGGTTGACCCGACTTGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921925026 Original CRISPR GGGTTGACCCGACTTGCAAT GGG Intergenic