ID: 921925325

View in Genome Browser
Species Human (GRCh38)
Location 1:220706217-220706239
Sequence GAAGATGCCCAGATTCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921925325_921925326 -8 Left 921925325 1:220706217-220706239 CCTAGCTGAATCTGGGCATCTTC No data
Right 921925326 1:220706232-220706254 GCATCTTCTGCAAAACAGTGCGG No data
921925325_921925327 5 Left 921925325 1:220706217-220706239 CCTAGCTGAATCTGGGCATCTTC No data
Right 921925327 1:220706245-220706267 AACAGTGCGGTTGAAGTAGATGG No data
921925325_921925328 29 Left 921925325 1:220706217-220706239 CCTAGCTGAATCTGGGCATCTTC No data
Right 921925328 1:220706269-220706291 ACATTCATCCCTCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921925325 Original CRISPR GAAGATGCCCAGATTCAGCT AGG (reversed) Intergenic
No off target data available for this crispr