ID: 921930210

View in Genome Browser
Species Human (GRCh38)
Location 1:220748582-220748604
Sequence GCCCTGGCCCAGGTGGCTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 311}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921930190_921930210 29 Left 921930190 1:220748530-220748552 CCATGGGCGCTTCCAGCTCCTCC 0: 1
1: 0
2: 3
3: 48
4: 321
Right 921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG 0: 1
1: 0
2: 2
3: 27
4: 311
921930195_921930210 8 Left 921930195 1:220748551-220748573 CCGCGCTGGCCCGCCTCGGCCTC 0: 1
1: 0
2: 4
3: 52
4: 400
Right 921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG 0: 1
1: 0
2: 2
3: 27
4: 311
921930198_921930210 -2 Left 921930198 1:220748561-220748583 CCGCCTCGGCCTCCCAGCCCGGC 0: 1
1: 3
2: 11
3: 126
4: 1372
Right 921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG 0: 1
1: 0
2: 2
3: 27
4: 311
921930196_921930210 -1 Left 921930196 1:220748560-220748582 CCCGCCTCGGCCTCCCAGCCCGG 0: 1
1: 0
2: 24
3: 500
4: 8679
Right 921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG 0: 1
1: 0
2: 2
3: 27
4: 311
921930194_921930210 11 Left 921930194 1:220748548-220748570 CCTCCGCGCTGGCCCGCCTCGGC 0: 1
1: 0
2: 3
3: 22
4: 231
Right 921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG 0: 1
1: 0
2: 2
3: 27
4: 311
921930199_921930210 -5 Left 921930199 1:220748564-220748586 CCTCGGCCTCCCAGCCCGGCCCT 0: 1
1: 0
2: 3
3: 99
4: 866
Right 921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG 0: 1
1: 0
2: 2
3: 27
4: 311
921930192_921930210 17 Left 921930192 1:220748542-220748564 CCAGCTCCTCCGCGCTGGCCCGC 0: 1
1: 2
2: 4
3: 31
4: 312
Right 921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG 0: 1
1: 0
2: 2
3: 27
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921930210 Original CRISPR GCCCTGGCCCAGGTGGCTCG GGG Exonic
900315463 1:2053986-2054008 CCCCAGGCCCAGGTGGCCCAGGG + Intronic
900356616 1:2268121-2268143 GCCCTGGCCCAGGTGCCCCCTGG + Intronic
900520960 1:3105307-3105329 GCTCTGGGCCAGGTGCCTGGAGG - Intronic
901533144 1:9866197-9866219 GGCCTGGCCCAGGTTGCAGGGGG + Intronic
901790278 1:11650257-11650279 GCCCTGCCCCAGCTGGCTGAGGG + Intronic
902359659 1:15935506-15935528 GCCCTGGGAGAGGTGGCTCAGGG - Exonic
902397259 1:16139133-16139155 GTCCTGGCCCAGCAGGCTGGGGG + Intronic
902518460 1:17002358-17002380 GCCATGGTCCAGGAGGCTGGGGG + Exonic
902623337 1:17662981-17663003 GCCATGGCCCAGGCTGCTCCAGG + Intronic
903329540 1:22590213-22590235 GCCCTGGCCCACCTGTCTCTAGG + Intronic
903474972 1:23613359-23613381 GCCCTGGCCCAGGTGGGGCGGGG - Intronic
904424194 1:30413090-30413112 GCCCTGCCACAGCAGGCTCGCGG - Intergenic
904424370 1:30414094-30414116 GCCCTGCCACAGCAGGCTCGCGG - Intergenic
904979009 1:34480605-34480627 GCCCAAGCTCAGGTGGCTAGAGG - Intergenic
905117567 1:35655448-35655470 GCCCTAGGCCAGGAGGCTCCTGG - Intergenic
905296171 1:36955858-36955880 ACCCTGGCCCTGGTGGCCAGCGG - Intronic
905885292 1:41488470-41488492 GCCCCAGCCCAGGCGGCTCCAGG - Intergenic
906537306 1:46558606-46558628 GCCCTGGCCCAGGCAGGCCGTGG - Exonic
907247197 1:53115805-53115827 GCCCAGGCCAGGGTGGCTAGGGG - Intronic
907486440 1:54781337-54781359 GCCCGGGCCCTGGTGGCCCAGGG - Exonic
908401389 1:63774963-63774985 GCCAGAGCCCAGGCGGCTCGCGG + Intronic
912691195 1:111805709-111805731 CCGCTGGCCCATGTGGCTAGGGG + Intronic
915592842 1:156880365-156880387 GCCCAGGCCCAGTTGGCCCCTGG + Intronic
915720199 1:157978990-157979012 GCCCGGGCCCAGCTGCCGCGGGG - Intergenic
918480739 1:184974321-184974343 GCCCTCGTCCAGCTGGCTGGAGG + Exonic
920048687 1:203150356-203150378 GCCCTGGCCTGGGTGGCTGCTGG + Intronic
921930210 1:220748582-220748604 GCCCTGGCCCAGGTGGCTCGGGG + Exonic
921934867 1:220786995-220787017 ATCCCGGCCCGGGTGGCTCGGGG + Exonic
922547657 1:226470796-226470818 GCCCTGCCCCATGGGGCTGGTGG + Intergenic
924145645 1:241072240-241072262 GCCCTGGCCAAAGTGGCCTGTGG + Intronic
924571396 1:245240817-245240839 GCTGTGGGCCAGGTGGCTCAGGG + Intronic
924740564 1:246792141-246792163 GCCCTGGAGTAGGTGGCCCGGGG + Intergenic
1063015255 10:2070612-2070634 GCCCTGACCCAGCTTGCTGGTGG - Intergenic
1064338049 10:14461388-14461410 GCCCTGGCCCAGCTAGTTCCTGG + Intronic
1066292756 10:34029109-34029131 GGCCAGGACCAGATGGCTCGAGG - Intergenic
1067062592 10:43085474-43085496 GCTCTGGCCTAGGTGGCCCCTGG - Intronic
1067148654 10:43711814-43711836 GCCCTGGACCTGGTGTCTCTGGG - Intergenic
1067478795 10:46582486-46582508 GCCCTGGCCTATGGGGCTCAGGG + Intronic
1067615944 10:47759315-47759337 GCCCTGGCCTATGGGGCTCAGGG - Intergenic
1069981151 10:72253676-72253698 GCCCTGAGCCAGGTGGCTATAGG + Intergenic
1072731552 10:97850140-97850162 GCCCGGGCTCAGGTGGGCCGGGG - Intergenic
1073035681 10:100562840-100562862 GCTCTGGCCCGGGTGGCGGGAGG + Intergenic
1073328958 10:102658531-102658553 GCCGGGGCCCAGGTGGCATGGGG - Intergenic
1076536104 10:131178707-131178729 GCCCTGCCCCAGGTGTCTCCGGG + Intronic
1076841920 10:133050031-133050053 TCCCTGGCCCTGCTGGCTTGGGG - Intergenic
1076846781 10:133073133-133073155 GGCCTGGCCCCGGGGGCTCGTGG - Intronic
1077057027 11:598830-598852 GCCCAGGCCCAGATGGCTTCAGG - Intronic
1077112201 11:866789-866811 GCCCTAGCTCAGGTGGCTTCAGG + Exonic
1077373870 11:2196047-2196069 GCTGTGGCCCAGCTGGCTCTGGG + Intergenic
1078094359 11:8287578-8287600 GGCCAGGCCCAGGAGGCTCCTGG + Intergenic
1078347992 11:10568464-10568486 GCCTTGGACCAGGAGCCTCGTGG + Exonic
1079099826 11:17534175-17534197 GCCCTGGGCCGGGAGGCTGGAGG - Intronic
1083429158 11:62604997-62605019 GCCAAGGCGCAGGTGGCTCCTGG + Intronic
1083776737 11:64897790-64897812 GCCCTGGGCCAGATTGCTGGGGG - Intronic
1083778528 11:64906397-64906419 GCCCTGGCCCTTGCGGCCCGAGG + Exonic
1083804427 11:65065763-65065785 GCCCTGGGCCAGAGGGCTCCTGG + Intergenic
1083826855 11:65208833-65208855 AGCCTGGCCCAGGAGGCTCTGGG - Intronic
1087068856 11:94054979-94055001 GCTGTGGCCCAGTTGGCTTGAGG + Intronic
1089299731 11:117491431-117491453 GCCATGGCCCAGGTCATTCGTGG + Intronic
1089555778 11:119315412-119315434 GGGCTGGCCCAGGTGGGGCGCGG - Intronic
1090029738 11:123196182-123196204 AACCCGGCCCAGGAGGCTCGCGG + Intergenic
1090972093 11:131652850-131652872 GCCCTGGCACAGGTGGCCATGGG + Intronic
1091347870 11:134867271-134867293 GCCCCTGCCCAGCTGGCTCCCGG - Intergenic
1092255068 12:6922425-6922447 CCCCTGGCCCAGATGGCTAAAGG + Intronic
1094819114 12:34211209-34211231 CCCCGGACCCAGGTGGGTCGTGG - Intergenic
1097895995 12:64825140-64825162 GCCCCGCACCAGGTGGCACGCGG - Intronic
1103336629 12:120194772-120194794 GCCCTGCCCCCGCTGGCTCCCGG - Intergenic
1103366759 12:120389536-120389558 GCACTGGCCCAGGGGGCTGCAGG - Intergenic
1104974311 12:132545648-132545670 GCTCTGGCCCATGGGTCTCGGGG + Intronic
1106978626 13:35251854-35251876 GCTGTGGCCCAGTTGGCCCGCGG - Intronic
1108321001 13:49290514-49290536 GCCCTGGCCCAGGTGTCCTTAGG + Intronic
1110567239 13:76968530-76968552 CCCCTGACCCACGTGGCTCTCGG + Intergenic
1114059716 14:19007986-19008008 ACCCTTGCACAGGTGGCTGGTGG - Intergenic
1114060530 14:19012900-19012922 ACCCTTGCACAGGTGGCTGGTGG - Intergenic
1114101726 14:19387078-19387100 ACCCTTGCACAGGTGGCTGGTGG + Intergenic
1114102829 14:19393765-19393787 ACCCTTGCACAGGTGGCTGGTGG + Intergenic
1114631971 14:24164873-24164895 GGCCTGGCCCAGGTGGAGCCTGG - Exonic
1115718976 14:36138837-36138859 GGCCGGGCGCGGGTGGCTCGCGG + Intergenic
1118213636 14:63788213-63788235 TCCCTGTCCCAGCAGGCTCGCGG - Intergenic
1118589365 14:67389949-67389971 GCCCTGGCCTAGCTGGGTCCAGG + Intronic
1118593925 14:67421485-67421507 GCCCTGGCCTGGGTGTCTGGTGG - Intergenic
1119825498 14:77654162-77654184 GCCCTGGCCCAGGGAGCACGTGG + Intergenic
1121529799 14:94644296-94644318 GCACTGGCCCAGGAGTCTGGAGG + Intergenic
1122615014 14:103011201-103011223 GCCCTGCCCCAGGAGGCCCGTGG - Intronic
1122805350 14:104253617-104253639 GCCCTGGTCCTGGGGTCTCGTGG + Intergenic
1122833865 14:104421506-104421528 GGCTTGGCCAGGGTGGCTCGTGG + Intergenic
1122899936 14:104778239-104778261 GCCCTGTCCCAGGTGCCACCAGG + Intronic
1124413698 15:29457485-29457507 GCCCTGGCCCTGGTGCCTGCTGG + Intronic
1128868142 15:71131417-71131439 GGCCGGGCACGGGTGGCTCGCGG + Intronic
1129227750 15:74179811-74179833 GCCCTGGCTCAACTGGCTCCTGG + Intronic
1129850148 15:78789181-78789203 GCCAGGGCACAGGTGGCTGGAGG + Intronic
1130252114 15:82306395-82306417 GCCAGGGCACAGGTGGCTGGAGG - Intergenic
1130891483 15:88137368-88137390 CGCCTGGCCCAGCTGGCTCCAGG - Intronic
1131228768 15:90645860-90645882 GCCCGGGCCCACCTGGCTCGTGG + Intergenic
1132607800 16:800780-800802 GCCAGGGCCCAGGTGGCGGGAGG - Intergenic
1132688522 16:1172185-1172207 GCCCTGGGCCAGCCGGATCGAGG - Intronic
1132733117 16:1372690-1372712 GGTCTGCCCCAGGTGGCACGTGG - Intronic
1132805149 16:1771803-1771825 GCCCTGGCCGGGGGGGCGCGGGG - Intergenic
1132929580 16:2451962-2451984 GTTCTGGCCCTGGTGGGTCGTGG + Intronic
1133433974 16:5763473-5763495 CCCCTGGCCCAGGAGGCTCTTGG + Intergenic
1136557983 16:31019901-31019923 GTCCTGTGCCAGGTGGCACGGGG + Intergenic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138553663 16:57760242-57760264 GGCCTGGCTCAGGTGGCCCTGGG - Intronic
1139468772 16:67167391-67167413 GACCTGGCCCAGGTGGGTGTTGG + Intronic
1140470183 16:75209398-75209420 GCCGGGGCCCTGGTGGATCGGGG + Intergenic
1141395027 16:83696926-83696948 GCCCTGGCCCAGGAAGCCCCTGG + Intronic
1142074775 16:88111062-88111084 GCACCGGCCCAGGTGCCTGGGGG - Intronic
1142112831 16:88341304-88341326 GCCCTGGCCCATGCGCCTCCTGG - Intergenic
1142271900 16:89094127-89094149 GCCCGGCCCCAGGCGGCTCGCGG - Intronic
1142805763 17:2370329-2370351 GCCCTGCCCCACGTGGGCCGTGG + Intronic
1143486687 17:7259150-7259172 GCCCAGGCCCAGGGTGCTCTGGG - Intronic
1144494082 17:15736142-15736164 GCCCTGGCCCTGGTAGGTTGTGG + Intronic
1144731295 17:17527970-17527992 GCCCTGGGCCAGGTGGTGGGGGG - Intronic
1144906178 17:18640537-18640559 GCCCTGGCCCTGGTAGGTTGTGG - Intronic
1145814992 17:27789068-27789090 GCACTGGCCCAGGTCGCCCGGGG - Intronic
1146511400 17:33452258-33452280 GCCCTGGCCTTGGTTGCTCTTGG + Intronic
1147376613 17:40026474-40026496 CCTCTGGCCCAGGTAGCTCTGGG - Intronic
1147743151 17:42679998-42680020 GCCGTGGCGCAGGTGGCCCTGGG - Exonic
1148455340 17:47808269-47808291 GCCCTGGCCCCGGGGGCAGGAGG - Exonic
1148715128 17:49710625-49710647 GCCCAGCCCCAGGTGGGTAGTGG - Exonic
1149008657 17:51832128-51832150 ACCCTTGCCCAGGTGGCACTGGG - Intronic
1151715189 17:75827613-75827635 GCCCTGGCCCATCTGCCTCCTGG - Exonic
1151977541 17:77491007-77491029 TCCCTGGCCCAGGTGGCTGCTGG + Intronic
1152093009 17:78257291-78257313 GGGCTGGCCCAGGTGACCCGGGG - Intergenic
1152244275 17:79177104-79177126 GTCCTGGCCCAGGTGCCACATGG + Intronic
1152359052 17:79821867-79821889 GCCCTGTACCAGGAGGCTCCTGG - Intergenic
1152656986 17:81524327-81524349 TCCCTGGACCAGGGGGCTGGGGG + Intergenic
1152659991 17:81537641-81537663 CGCCTTGCCCACGTGGCTCGGGG - Intergenic
1152734262 17:81989424-81989446 GCACTGGCCCAGGAGGCTTGGGG + Intronic
1152893496 17:82896261-82896283 CCCCTGGCCCTGGAGGCTCGGGG - Intronic
1152945040 17:83193565-83193587 GCCCTGGCCTGGGTGGGTGGGGG + Intergenic
1153556254 18:6316843-6316865 GCCCTGACAGAGGTGGCTGGGGG - Intronic
1153886828 18:9475145-9475167 GTGCTGGCGAAGGTGGCTCGCGG - Exonic
1153954095 18:10081347-10081369 GCTCTGGCACAGGAGGCTGGAGG + Intergenic
1154358868 18:13642655-13642677 GCCCTGGCAGAGGTGGCCCGGGG - Intronic
1155148449 18:23103631-23103653 CCCCTGCCCCAGGTAGCTGGTGG - Intergenic
1157186055 18:45540829-45540851 GCCCTGTGCCAGGTGGCAAGAGG - Intronic
1157196457 18:45624013-45624035 GCCCTGACCCTGGTGGTACGGGG + Intronic
1158951529 18:62499661-62499683 AACCTGGCCCTGGTGGCTGGAGG + Intergenic
1159988512 18:74874461-74874483 GCCCTATCCCTGGTGGCTGGAGG + Intronic
1160506872 18:79432296-79432318 GCCCCGGCCCACGGTGCTCGGGG + Intronic
1160513724 18:79466980-79467002 CCCCTTGCCCAGGTGGCCCCGGG + Intronic
1160578426 18:79870034-79870056 GCCCACCCCCAGGTGGCTGGGGG - Intronic
1160740064 19:681486-681508 GGCCTGGCGCATGTGGCACGAGG - Exonic
1160752376 19:740506-740528 GCTCTGGCCCAGGTGGAGGGAGG - Intronic
1160817472 19:1042812-1042834 GACCTGGCCCAGGAGGTACGAGG + Exonic
1161016414 19:1985849-1985871 GCCCTGGCCCAGGTGGTGAGCGG - Exonic
1161034800 19:2078598-2078620 GTCCTGGGCCAGCTGGCTGGGGG + Exonic
1161063884 19:2228225-2228247 GCCCTGGCCCAGGCCGCGCCCGG + Intronic
1161118551 19:2512711-2512733 GCCCTGGCAGCGGGGGCTCGGGG + Exonic
1161410519 19:4114557-4114579 TCCCTGGCCCAGGTAACGCGGGG + Intronic
1161685460 19:5700613-5700635 GCCCTGCCCCCGAGGGCTCGAGG - Intronic
1161943203 19:7418742-7418764 GCCCCGGCCCATGTGGCTGATGG + Intronic
1162029672 19:7911956-7911978 GCCCTAGGCCAGGAGGCTCCGGG + Intronic
1162043703 19:7985358-7985380 CCCCTGGTGCAGGTGGCTTGTGG - Intronic
1162216679 19:9140433-9140455 TCCTTGGCCCATGTGTCTCGGGG - Exonic
1162494969 19:11018447-11018469 GGCCTGGCTCAGGTGGCAGGCGG - Intronic
1162573694 19:11486734-11486756 GGCCTGGCCCAGGCTGCTCCGGG + Intronic
1162964993 19:14151352-14151374 CCCCTGGCACAGGTGGCACAGGG + Exonic
1164473433 19:28554670-28554692 GGCCTGGCCCAGCTGTCTCTAGG - Intergenic
1165407419 19:35639267-35639289 GGTCTGGCCCAGGTGGCAGGGGG - Intergenic
1166364504 19:42271844-42271866 GCCTTGGCCCTGGTGGCTGGGGG - Intronic
1166378926 19:42344448-42344470 GCCCAGGCCCAGGCAGCTGGCGG - Exonic
1166379490 19:42348431-42348453 GTCCTGGCCCGGATGGCCCGTGG + Exonic
1166379852 19:42350257-42350279 GCCCTGGCGCAGGTGGCAGGTGG - Exonic
1166406662 19:42526596-42526618 GCCCTGGCCCAGGCTCCTCAGGG + Intronic
1167674316 19:50874998-50875020 GTCCTGGCCCAGGTCGCACCCGG + Intronic
1168347144 19:55655403-55655425 GTCCTGGCGGAGGTGGCGCGGGG + Intronic
1168559398 19:57370615-57370637 GCCCTGGCCCTGGTAGCTCAAGG + Intronic
1168562563 19:57396209-57396231 GCCCTGGCCCTGGTAGCTCAAGG + Intronic
1168630080 19:57949705-57949727 GCCCTGGCTCCGGAGTCTCGAGG + Intergenic
1168721405 19:58556779-58556801 ACCCTGGCCCACCTGGCTCCAGG + Exonic
926084047 2:10010025-10010047 TAGCTGGCCCAGGTGGCTGGCGG + Intergenic
928179778 2:29060586-29060608 GCCCTGCATCAGGTGGCTCTAGG - Exonic
929794311 2:45047335-45047357 TCCCTGGCACAGATGGCCCGTGG + Intergenic
930684361 2:54291692-54291714 GATCTAGCCCATGTGGCTCGGGG + Intronic
931968105 2:67555930-67555952 GCCGTGGCCTAGTTGCCTCGTGG - Intergenic
932337035 2:70937466-70937488 GCCCTGCCCCATGGAGCTCGGGG + Intronic
934563662 2:95326671-95326693 CCCCTGGGCCAGGTGGCCAGAGG - Intronic
935468013 2:103422527-103422549 GCCCTGGCTCAGATGGCACAAGG - Intergenic
935697823 2:105785353-105785375 GTCCTGGCCAAGGAGGCTAGTGG + Intronic
938291290 2:130152178-130152200 GGCCAGGCCCAGGTGGCTGTTGG + Exonic
938316422 2:130332379-130332401 GCCCAGGGCCTGGTGGCTCACGG - Intergenic
938465253 2:131520781-131520803 GGCCAGGCCCAGGCGGCTCTTGG - Intergenic
938989459 2:136612903-136612925 GCCATGGTCCAGATGGCTCGAGG - Intergenic
940083354 2:149829627-149829649 GCCCTGGCGCAGGGGGCTTCAGG - Intergenic
942457963 2:176150901-176150923 GCCCTTGCCCATGTAGCTGGGGG - Intergenic
942547677 2:177081528-177081550 CCACTGTCCCAGGTGGCCCGCGG - Intergenic
944047289 2:195427738-195427760 GCCCTGGCTCAGGAGGCTGAGGG + Intergenic
946486234 2:220103314-220103336 GCCCTTGCCCAGGAGGCCAGAGG + Intergenic
946865540 2:224038896-224038918 GCCCCGGCCAAGGCGGCCCGCGG + Intronic
948487168 2:238288448-238288470 GCCCTGTCCCAGGTGGAGAGTGG - Exonic
1170612800 20:17928513-17928535 GCCCAGGTCAAGGTGTCTCGAGG + Intergenic
1171168832 20:22997504-22997526 GGCCAGGCCCAGATGGCTCTTGG - Intergenic
1172009126 20:31836274-31836296 GGCCTGGCCCAGCTGGCAGGTGG - Intergenic
1173835933 20:46125669-46125691 GACCTGGTCCAGGTGGCCCCAGG - Intronic
1174661743 20:52219710-52219732 GCCCTGATGCAGGTGGCTTGTGG - Intergenic
1174714078 20:52738038-52738060 TCCTGGGTCCAGGTGGCTCGGGG + Intergenic
1175399650 20:58693092-58693114 GCCCAGGCCCGGGCGGCCCGCGG + Intronic
1175788383 20:61726070-61726092 GCCCTGGTCGTGGTGGCTGGGGG - Intronic
1176041016 20:63065914-63065936 GCACTGGCCACGGAGGCTCGTGG + Intergenic
1176074076 20:63240586-63240608 GCCCAGGTCCAGCTGGCTCCAGG + Intergenic
1176109665 20:63405606-63405628 GCCCTGCCCCAGGTCTGTCGGGG + Intergenic
1176220433 20:63967034-63967056 GCAGTGGCCCAGGTGGCTGCGGG - Intronic
1176411163 21:6450323-6450345 GCCCTGCCCCAGGCTGCTCAGGG + Intergenic
1178487205 21:33026657-33026679 GTCCCGGCACAGGTGGCCCGTGG - Exonic
1179686656 21:43058645-43058667 GCCCTGCCCCAGGCTGCTCAGGG + Intronic
1180478197 22:15730598-15730620 ACCCTTGCACAGGTGGCTGGTGG - Intergenic
1180479012 22:15735512-15735534 ACCCTTGCACAGGTGGCTGGTGG - Intergenic
1180786952 22:18552816-18552838 CCCCTGGCCTAGGTGGCCCCTGG - Intergenic
1180830575 22:18903942-18903964 GCCCAGCCCCAGCTGGCTCCTGG + Intergenic
1180936051 22:19625940-19625962 GCCCTGGCCCAGGTGGCGGGAGG - Intergenic
1180968088 22:19800924-19800946 GCCCTGGCCCCTGTGGGGCGGGG - Intronic
1181069104 22:20321342-20321364 GCCCAGCCCCAGCTGGCTCCTGG - Intergenic
1181234788 22:21442490-21442512 CCCCTGGCCTAGGTGGCCCCTGG + Exonic
1181243862 22:21492341-21492363 CCCCTGGCCTAGGTGGCCCCTGG - Intergenic
1181309032 22:21933791-21933813 GGGCTGCCCCAGGTGGCTCCTGG + Intronic
1181680830 22:24494933-24494955 GCCCTGGCGCGGGTGCCTCCAGG - Intronic
1181712281 22:24697975-24697997 GCCCCTCCCCAGGTGGCTGGGGG - Intergenic
1182796361 22:32994279-32994301 GTCCTGGCCCTGGTGTCTGGGGG - Intronic
1183392257 22:37552320-37552342 GACCTGGGCCAGGTGGTTCGGGG - Intergenic
1183432487 22:37774222-37774244 GCCCTGGCCCAGAGGTCTGGCGG + Exonic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1184262397 22:43326464-43326486 CCCCTGTCTCCGGTGGCTCGGGG + Intronic
1184368688 22:44068893-44068915 GCCCTGGCCCATGAGGCTGATGG + Intronic
1184668504 22:46000956-46000978 CTTCTGGCCCACGTGGCTCGGGG - Intergenic
1184695528 22:46136964-46136986 GCCCTGGCCCATGTAGCTGAGGG - Intergenic
1184720844 22:46312256-46312278 GCCCTGGCCCAAGTGGCTTCCGG - Exonic
1185329160 22:50244382-50244404 GCGCTGGCCCAGGTGAGTCTTGG + Exonic
1203280665 22_KI270734v1_random:129213-129235 GCCCAGCCCCAGCTGGCTCCTGG + Intergenic
950118849 3:10468429-10468451 GCCCTGGGCCAGAGGGCTGGCGG + Intronic
950406792 3:12810000-12810022 AGCCTGGCCCAGGTTGCCCGCGG + Intronic
954809679 3:53240304-53240326 GCCCTGGCCCAGGGAGCCAGTGG + Exonic
954957147 3:54531315-54531337 GTCCTGGCCCAGCTGCCTCTTGG + Intronic
956740574 3:72272525-72272547 GCTCTGTCCCAGGTGCCTGGAGG - Intergenic
960055267 3:113272520-113272542 TCCTTGGCCCAGGTGACCCGTGG - Exonic
961326728 3:126113388-126113410 GCCCTGGCCCAGGGAACTCCTGG + Intronic
961713694 3:128845309-128845331 GCCCTGGTCATGGTGGCTAGGGG - Intergenic
962891620 3:139677627-139677649 GCCCGGGCCCACGTGACTCCTGG - Intronic
963060446 3:141220894-141220916 TCCCTGGGCCAGGTGGCCTGGGG - Intergenic
966687257 3:182709535-182709557 GCCCAGCCCCAGGTGGTTCTAGG + Intergenic
967477310 3:189936861-189936883 GCCCTGCCCAAGCTGGCTCTGGG - Intergenic
968555101 4:1242847-1242869 CCCCTGGCCAGGCTGGCTCGTGG - Intronic
968729868 4:2264634-2264656 GGCCTGGCCCAGATGGCTGCAGG + Intergenic
968834724 4:2955075-2955097 GCCGTGGCGCAGGTGACTAGAGG - Intronic
968834754 4:2955187-2955209 GCCGTGGTCCAGGTGACTAGAGG - Intronic
968834793 4:2955353-2955375 GCCGTGGTCCAGGTGACTAGAGG - Intronic
968878666 4:3287559-3287581 CCCCTGGCCCTGGCGGCCCGAGG + Intergenic
969253923 4:5990022-5990044 GCCCTGGAGAAGGTGGCTGGGGG + Intergenic
974686740 4:65241573-65241595 GCCCTGGCTCAGGAGTCTCTAGG + Intergenic
981122061 4:141063596-141063618 GCCCTTTCCCAGGTGGCTACTGG - Intronic
982291850 4:153789428-153789450 GCCCGGGCCCCGGCGGCACGCGG - Intergenic
985069569 4:186154874-186154896 GCCCTGGTCCTGGGGGCTCCAGG + Intronic
985071676 4:186171623-186171645 GTCCTGGCCCAGGAGGCTGAGGG - Intronic
985794481 5:1952193-1952215 GCCCTGGGGCATGTGGCTGGCGG + Intergenic
986708495 5:10470778-10470800 GCCCTGGCCGTGGGGCCTCGGGG + Intronic
987496631 5:18653257-18653279 TCCCAGGCCCAGGTAGCTCATGG - Intergenic
988476706 5:31592412-31592434 TCCCTGTCCCAGGTGACTGGGGG + Intergenic
991258219 5:64638407-64638429 TCCCTGGCAAAGGTGGCTCTTGG - Intergenic
997470722 5:134115429-134115451 GCCCTGGCCTCGGTGGGACGGGG + Intronic
999192615 5:149759798-149759820 CCCCTGGCCCAGGGGGCTCTTGG - Intronic
1001086042 5:168700730-168700752 GCCATGGCCCAGGGGACTCCAGG + Intronic
1001159528 5:169300973-169300995 CCCCTGGCCCCGCTGGCCCGCGG + Intronic
1001297302 5:170506959-170506981 GCCCTGGCTGAGGAGGCTAGTGG + Intronic
1001572159 5:172736932-172736954 GCCTTGGCTCAGGGGGCTGGGGG + Intergenic
1002089953 5:176798543-176798565 GCCCTGGGCCTGGTGCCTGGGGG + Intergenic
1004380929 6:15131936-15131958 GCCCTCCCCCAGGTGACTCCAGG + Intergenic
1006386334 6:33733134-33733156 GCCCTGACCCAGGTCCCTCCTGG + Intronic
1006831291 6:36969738-36969760 ACTCTGGCCCAGGTGGCAGGTGG - Intronic
1007700460 6:43763318-43763340 GCCCAGGCCCAGGGGGCTGCTGG + Intergenic
1007714894 6:43850316-43850338 ACCCTGGCTCAGGTGGCTTCAGG + Intergenic
1014658133 6:124132708-124132730 GCCCTGGTGGAGGTGGCTGGGGG - Intronic
1014797874 6:125747727-125747749 GTACTGGCCCAGGGCGCTCGGGG + Intronic
1015398180 6:132758845-132758867 CCTCTGGCCTAGGTGCCTCGGGG - Intronic
1017103192 6:150866066-150866088 GCCCTGGCCCAGGTCTCCAGCGG + Intronic
1018948982 6:168366027-168366049 GCCCTGGCCCTGGTAGGTCACGG - Intergenic
1019360496 7:602136-602158 GCCCTGGCCCAGTTAGCGTGGGG - Intronic
1019435412 7:1019948-1019970 GCCCTCGTCCAGGTGCCCCGTGG - Intronic
1019609266 7:1928726-1928748 GGCCCTGCCCAGGTGGCACGGGG + Intronic
1019644359 7:2121140-2121162 GAGCTGGACCAGGTGGCTCTGGG + Intronic
1020086494 7:5313385-5313407 GCCCAGGCTCAGGAGGCTCTTGG + Exonic
1021934363 7:25615272-25615294 GCCCTGGCCCTGGTGTCCCGTGG - Intergenic
1022482239 7:30751893-30751915 GCCCTGGCCCTGCTGCCTCTAGG - Intronic
1022582010 7:31564829-31564851 GCCCCGGCCCAGGTGTCTTCAGG - Intronic
1024241313 7:47438639-47438661 GCCCTGGCCCAGGTGCTACCTGG - Intronic
1024635962 7:51290752-51290774 GTGCTGGCCCAGGTGTCTGGGGG - Intronic
1025207820 7:57003753-57003775 GCCCAGGCTCAGGAGGCTCTTGG - Intergenic
1025664119 7:63573119-63573141 GCCCAGGCTCAGGAGGCTCTTGG + Intergenic
1026769712 7:73187922-73187944 GCTGTGGCCCAGTTGGCTGGAGG + Intergenic
1026873066 7:73865065-73865087 GGGCTGGCCCAGGAGGCCCGGGG + Exonic
1026933880 7:74240703-74240725 GCCCTGGCCCAGGTGGACTCTGG + Intronic
1026981887 7:74531763-74531785 GCCCTGGCCCAGGTATCTGCAGG + Intronic
1026982757 7:74536287-74536309 CCCCTGGCCCCGGAGGCCCGCGG + Intronic
1027004791 7:74684088-74684110 GGCCTGGCTCAGGTGGCTTCTGG + Intronic
1027010580 7:74741304-74741326 GCTGTGGCCCAGTTGGCTGGAGG + Intronic
1027077462 7:75204736-75204758 GCTGTGGCCCAGTTGGCTGGAGG - Intergenic
1029737243 7:102471779-102471801 GCCATGGCCCAGGGGGCTGTTGG - Intronic
1029737264 7:102471840-102471862 GCCATGGCCCAGGGGGCTGTTGG - Intronic
1034393266 7:150801674-150801696 CCCCTGGCCTGGGTGGCCCGGGG - Exonic
1034401631 7:150865245-150865267 GCCATGGCCGAGGTGGGTAGTGG - Intergenic
1034491003 7:151392957-151392979 AGCCTGGCCCAGGTGGCCAGTGG - Intronic
1034941617 7:155234301-155234323 GCCCTGGCCCTGGTTCCTTGTGG - Intergenic
1035945100 8:3953922-3953944 GCCCTGGCAAGGGTGGCTCTGGG + Intronic
1036424707 8:8633716-8633738 GCCCTGGCCCACCAGGCTAGAGG + Intergenic
1036778458 8:11629458-11629480 GCCCTGGCTCAGAAGCCTCGAGG - Intergenic
1037907518 8:22724237-22724259 TCCCTGGCCCTGGTGGCAGGAGG + Intronic
1039618357 8:38974667-38974689 GACCTTGCCCAGGCGGCGCGCGG - Exonic
1040471296 8:47737785-47737807 GCCCGGGCCCAAGGGGCGCGCGG + Exonic
1043982322 8:86657210-86657232 GCCCTGGCCAAGGTGGCAAAGGG + Intronic
1048882880 8:138884712-138884734 GCCCTGGTCCAGGGTGCTAGTGG - Intronic
1048970099 8:139640596-139640618 GCACAGGCCCTGGTGGCTTGGGG - Intronic
1049014507 8:139910114-139910136 CCCCAGGCCCAGGTGGCCCCTGG + Intronic
1049228171 8:141467579-141467601 GCCCAGGCCCAGGGGGCCCAAGG - Intergenic
1049544147 8:143221715-143221737 CCCCTGCCCCAGGTGGCTCCGGG - Intergenic
1049752972 8:144294356-144294378 GCCCAGGCCCAGCTGGCTCTCGG + Intronic
1051530459 9:18096454-18096476 CCACTGGCCCATGTGGCTCTTGG + Intergenic
1051874438 9:21776543-21776565 GCCCTGGCACAGGTGGAAGGGGG + Intergenic
1054715672 9:68555841-68555863 GCCCTGGCCTAGATGGCAAGGGG - Intergenic
1056754575 9:89373709-89373731 GCCCTGCCCTGGGTGGCTGGGGG + Intronic
1057212199 9:93206376-93206398 GCCCTGGCCTTGGTGGCTGAGGG + Intronic
1058747266 9:108003743-108003765 GCCCTTGCCAAGTTGGCTCTAGG - Intergenic
1059420427 9:114187108-114187130 TCCATGGCCCAGGTGGCTGCTGG + Intronic
1060033142 9:120232859-120232881 ACCCTGCCCCAGGTGGCCCTTGG + Intergenic
1061062238 9:128256298-128256320 GCCCTGGCCAAGGTGGCTAAGGG + Exonic
1061538058 9:131261574-131261596 GGCCTGGCCCAAGTTGCTCTAGG + Intronic
1061543621 9:131291120-131291142 GCCCTGTGCCAGGTGCCACGTGG + Intronic
1061544871 9:131298798-131298820 CCCCTAGCCCAGGTCCCTCGGGG - Intronic
1061892684 9:133631054-133631076 GCTCTGGCCCAGGAGGGTCTCGG - Intergenic
1061906816 9:133703260-133703282 GCCAGGGCCCAGGAGGCTGGAGG + Intronic
1061975996 9:134068217-134068239 GGCCTGGCCCGGGGGGCGCGCGG + Intronic
1062033259 9:134371590-134371612 GCCATGGCACTGGTGGCTTGGGG + Intronic
1062387093 9:136316981-136317003 ACCCTGTCCCAGGTGGCAGGAGG + Intergenic
1062447956 9:136603604-136603626 CCTCTGGCCCAGGTGCCTCCAGG + Intergenic
1062566046 9:137164421-137164443 ACCCTGTCCCAGGTGGGCCGTGG - Intronic
1062641170 9:137519379-137519401 GGCCTGGGCCAGGTGCCTGGTGG - Intronic
1189324910 X:40106212-40106234 GCCCTGGGCCAGGAGAGTCGGGG - Intronic
1192194212 X:69017896-69017918 TGCCTGGCCCAGGTGGCAAGAGG + Intergenic
1195203428 X:102571732-102571754 GTCCTGGCCCTGCTGGCTCATGG - Intergenic
1197130072 X:122995128-122995150 GCAGTGGCCCAGGTGTCTGGTGG - Intergenic
1197897499 X:131330857-131330879 GCCCTGGCCTAGATGGATCGTGG + Intronic
1200066537 X:153506752-153506774 GCTCTGCCCCAGGTGGCGGGAGG - Intronic