ID: 921930488

View in Genome Browser
Species Human (GRCh38)
Location 1:220750263-220750285
Sequence CTGGACACCTTCCAAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921930482_921930488 14 Left 921930482 1:220750226-220750248 CCTTCCTATTACTGGAAAGACTT 0: 1
1: 0
2: 0
3: 14
4: 166
Right 921930488 1:220750263-220750285 CTGGACACCTTCCAAAAAACTGG 0: 1
1: 0
2: 0
3: 17
4: 180
921930483_921930488 10 Left 921930483 1:220750230-220750252 CCTATTACTGGAAAGACTTCAGG 0: 1
1: 0
2: 0
3: 17
4: 124
Right 921930488 1:220750263-220750285 CTGGACACCTTCCAAAAAACTGG 0: 1
1: 0
2: 0
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921930488 Original CRISPR CTGGACACCTTCCAAAAAAC TGG Intronic
902438875 1:16416227-16416249 CTTAACACCTTGCAAAAAGCTGG - Intronic
903467444 1:23561716-23561738 CTGAGCACCTTCCACACAACTGG - Intergenic
905267956 1:36768016-36768038 ATGTACACCCTCTAAAAAACTGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907449800 1:54537960-54537982 CTTTACACCTTCCACAGAACAGG - Intergenic
907473647 1:54690882-54690904 TTGGACACCTTCTTACAAACTGG - Intronic
909531897 1:76691350-76691372 CTGCACTCCTTCCAAAACACAGG - Intergenic
909958381 1:81803628-81803650 CCTGACACCTTTCAAGAAACAGG - Intronic
910458650 1:87424963-87424985 CTGGACAACTTCCACAGAGCAGG - Intergenic
912528932 1:110306223-110306245 CTGGCCCCCTTCCACAAAAGTGG + Intergenic
915410519 1:155698085-155698107 CTGGGCACCTTGAAAAGAACAGG - Intronic
915752519 1:158224807-158224829 CTGGGCAACTTACAAAAAAAAGG - Intergenic
916889552 1:169103102-169103124 CTGGCCACCTTGCTACAAACAGG + Intergenic
919743292 1:200993262-200993284 TTGGACACCTTCCAAGTGACAGG + Intronic
920157732 1:203968884-203968906 CTGGATCCCCTCCAAAAAAGAGG + Intergenic
921930488 1:220750263-220750285 CTGGACACCTTCCAAAAAACTGG + Intronic
923421426 1:233819551-233819573 TTGGAAACCATCCAAAATACAGG + Intergenic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
1063905702 10:10778080-10778102 CTGGACTCTTTCCAAAATATGGG - Intergenic
1064033104 10:11895213-11895235 CTGGTCACCTTCCAGAAACAGGG + Intergenic
1065278807 10:24113985-24114007 CTGGTCACCTCCCATAAAGCTGG + Intronic
1068537457 10:58256097-58256119 CTGGCCACCTTGAAAAGAACAGG + Intronic
1069826084 10:71256135-71256157 CTGGAGATCTTCCAAAGAAGGGG - Intronic
1074184703 10:111090262-111090284 CAGGCCACATTCCACAAAACTGG - Intergenic
1074585773 10:114767148-114767170 CTAAACTCCTTCCAAAAAGCAGG + Intergenic
1076603983 10:131677618-131677640 CTGGAGTCCTTCCAAAACCCTGG + Intergenic
1086915792 11:92528686-92528708 CTGGACTCCCTCAAAAGAACTGG - Intronic
1087086107 11:94220220-94220242 CTGGGCACCTTGAAAAGAACAGG - Intergenic
1088818598 11:113438026-113438048 CTGGGCACCATCCTGAAAACAGG + Intronic
1095172683 12:39054632-39054654 CTGGGCACCTTGAAAAAAACAGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097384054 12:58928285-58928307 CTGACCACCTTCAAAAAACCAGG - Intergenic
1097515787 12:60603911-60603933 CTGGGCACCTTGAAAAGAACAGG - Intergenic
1097684898 12:62682108-62682130 CTGGACACCTCAAAAAAACCTGG - Intronic
1098583942 12:72134231-72134253 CTGGACACTTTCCAGAAAGAGGG + Intronic
1098839171 12:75458375-75458397 CTGGGCACCTTGAAAAGAACAGG - Intergenic
1098909045 12:76190694-76190716 CTAGACATGTACCAAAAAACAGG + Intergenic
1098950951 12:76640001-76640023 CTGGAGACCTTCTGAGAAACAGG - Intergenic
1099019595 12:77387025-77387047 CTGGGCAACTTCTACAAAACTGG - Intergenic
1099285075 12:80707348-80707370 CAGGACAACTTCAAAACAACTGG - Intergenic
1101057825 12:100937447-100937469 CTTGACAGCTCCCAAAACACTGG + Intronic
1112565400 13:100547703-100547725 CTGGAGACATTCAATAAAACAGG + Intronic
1115320215 14:32072236-32072258 CTGGAAACATTCTAAAGAACTGG - Intergenic
1119001166 14:70883380-70883402 CTGGAAGCCTTCCAAAACCCAGG + Intergenic
1127647829 15:60975343-60975365 CGGGACACCTTCCTAGAATCAGG - Intronic
1127768616 15:62212026-62212048 CTGGACACATTCCAAAGGCCAGG + Intergenic
1128738527 15:70067363-70067385 CTGGGCACCTTCCAACCACCTGG + Intronic
1130366980 15:83249523-83249545 CTGAACATCTTACAAAACACAGG + Intergenic
1131680127 15:94712637-94712659 CTGGACACTTGCCAACAACCAGG + Intergenic
1132214547 15:100053134-100053156 CGGGTCTCCTTCCAAAAAACAGG - Intronic
1133620528 16:7521851-7521873 ATGGACACGTTCCAAAAACCAGG - Intronic
1133932343 16:10242619-10242641 CTTGGCACCTTCCAAAAGATAGG - Intergenic
1136506490 16:30707421-30707443 CTGGTCCCCTTCCAACAAACCGG - Intronic
1138181159 16:54940922-54940944 GTGGACAGATTCCAAAAGACAGG - Intergenic
1138385133 16:56631403-56631425 CTGGAAATCTTCTAAACAACAGG - Intergenic
1139058112 16:63212430-63212452 CAGGACATCTTCAAAAAAAGTGG + Intergenic
1141258721 16:82430657-82430679 ATGGAAACCTTCAACAAAACAGG + Intergenic
1143583643 17:7840411-7840433 CTGAACACCCTCCAAAAGCCAGG - Intronic
1149489350 17:57071118-57071140 CTGGAAACCTTACAAACATCAGG + Intergenic
1150807727 17:68332353-68332375 CTGGGCATCTTGAAAAAAACAGG - Intronic
1151533184 17:74720789-74720811 CTGGACACCTGACAAGAACCCGG - Intronic
1151730743 17:75909775-75909797 CTGGACAAGTCCCAAAGAACAGG - Exonic
1151856179 17:76723792-76723814 CTGGAAATCTTACAAAAACCAGG - Exonic
1152604250 17:81281118-81281140 ATGGACATTTTCCAAAAGACTGG + Intronic
1152901754 17:82945679-82945701 CTGAACACCCTGCAATAAACAGG - Intronic
1157568343 18:48695789-48695811 CTGAACACCTTCCAGGAAACTGG + Intronic
1157733587 18:50026212-50026234 CTAGCCATCTTTCAAAAAACTGG + Intronic
1158225832 18:55200006-55200028 CTGAACAGGTTCCAAAAACCTGG - Intergenic
1159708488 18:71723539-71723561 ATGGACAACTTCCAAAACCCTGG + Intergenic
1159883538 18:73882689-73882711 CTAGATGGCTTCCAAAAAACAGG + Intergenic
1160555101 18:79719558-79719580 CAGGACACCTTCCTAACAACTGG - Intronic
1162789106 19:13053940-13053962 CTGGACACCTCCTAAAACAAAGG + Intronic
1163673022 19:18639762-18639784 ATGGAAGCATTCCAAAAAACTGG - Intronic
1164552443 19:29222620-29222642 TTGGACACATTCCTACAAACAGG - Intergenic
1164740759 19:30573875-30573897 CTGGACACCTTCCAACATGATGG + Intronic
1164759465 19:30718049-30718071 CTGGGCACGTTCCACCAAACTGG + Intergenic
927375165 2:22404920-22404942 CTGGACACCATGCAAACAATGGG + Intergenic
928832612 2:35506064-35506086 CAGGACAGCTTGAAAAAAACTGG - Intergenic
932010652 2:67974370-67974392 ATGGACACCTTCCAATGATCTGG - Intergenic
933191041 2:79334384-79334406 CTGTACATCATCCAATAAACAGG - Intronic
933649897 2:84842156-84842178 CTGGACAGCATCCAAAGAAAAGG + Intronic
934124164 2:88870202-88870224 CTGGATACCTTATAAATAACAGG - Intergenic
936806854 2:116344264-116344286 TTGGACACAATTCAAAAAACAGG - Intergenic
937415125 2:121708595-121708617 CAAGACTCCTTCAAAAAAACAGG - Intergenic
939425157 2:142026137-142026159 CTTGACAGTTTCCAAAAAGCAGG - Intronic
940793930 2:158057018-158057040 TCAGACACATTCCAAAAAACGGG - Intronic
944515609 2:200509563-200509585 CTGGACACTTTCCACATAGCAGG - Intronic
944854056 2:203749502-203749524 CTTAAAACCTTCCAAAAAATTGG - Intergenic
945724527 2:213459591-213459613 CTGAAGACCTTCCAAGAAATGGG - Intronic
948164848 2:235852947-235852969 TTTGACACCTTCCAACAAAGAGG + Intronic
1173591369 20:44227667-44227689 CTTGACACCTTACAATAAACAGG + Intergenic
1178569317 21:33720357-33720379 TCGGACACCTTCCACAAAACTGG - Intronic
1180790597 22:18573640-18573662 CTGCCCACCTCACAAAAAACCGG + Intergenic
1181231141 22:21421675-21421697 CTGCCCACCTCACAAAAAACCGG - Intronic
1181247508 22:21513193-21513215 CTGCCCACCTCACAAAAAACCGG + Intergenic
1183769071 22:39907939-39907961 CTGGGCCCCTTCCACAACACTGG + Intronic
1184704116 22:46198545-46198567 CAGGACAGCTTCCTAAATACTGG - Exonic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950844629 3:16002667-16002689 CTGCAAAAATTCCAAAAAACAGG - Intergenic
955953480 3:64265043-64265065 CTGGACAACTTCCAGAAGAATGG - Intronic
956246663 3:67191134-67191156 CTGACCACCTCCCAGAAAACTGG - Intergenic
956449132 3:69356072-69356094 GGGGACACCATCCAAATAACTGG + Intronic
956819692 3:72942724-72942746 CTGGACAGCTTTGAAAACACTGG - Intronic
957412209 3:79856687-79856709 CTGGATCAGTTCCAAAAAACTGG - Intergenic
957563177 3:81851378-81851400 CTGGACACCTTCCAAGAACTTGG - Intergenic
958178637 3:90028780-90028802 CTGAACACCTTTCAGAAAATAGG - Intergenic
960071748 3:113438972-113438994 CTGGACACTTTCCAGAAGAGCGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966996460 3:185285200-185285222 CTGGGCACTTTCCAGAAATCGGG - Intronic
967898886 3:194426616-194426638 CTGAACATCTTCCCAAAGACAGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970036894 4:11746405-11746427 CAGGATAGCCTCCAAAAAACTGG - Intergenic
970433419 4:16010191-16010213 ATGGACACTCTCCAGAAAACTGG - Intronic
973113690 4:46428142-46428164 ATGGACACATTCCAAACATCTGG + Intronic
974861951 4:67533137-67533159 CTGGGCGCCTTCCACAACACAGG - Intronic
975483462 4:74907722-74907744 CTAGACACCTTACATAAAACTGG + Intergenic
976263967 4:83172994-83173016 CTCGGCACCTTCCAAAAGACAGG - Intergenic
977707145 4:100084906-100084928 CTGGACACCTTCTAAGCACCAGG + Intergenic
980073316 4:128265977-128265999 CTGGGCACCTTGAAAAAAACAGG - Intergenic
982175055 4:152698090-152698112 CTGACCACCTTCCAAGCAACTGG + Intronic
982694262 4:158581836-158581858 CTGCAGACTTTCCAAAAAGCAGG + Intronic
983570287 4:169200042-169200064 ATGGACTCCATCCAAAAAAAAGG + Intronic
983863561 4:172736465-172736487 CTGGGCACCTTGAAAAGAACAGG - Intronic
985726421 5:1518204-1518226 CTGGACGCCTTCCAGAGAAAAGG + Intronic
988390705 5:30625569-30625591 GTAGACACTTTCCAAAGAACAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990981032 5:61602637-61602659 CTGGAGAGCTTCTAGAAAACTGG - Intergenic
996195152 5:120596350-120596372 CTGAACAATTTCCACAAAACCGG + Intronic
1002346157 5:178548430-178548452 CTGGGCATCATCCAAAAACCGGG + Intronic
1003281642 6:4697702-4697724 CTAAACACCAGCCAAAAAACAGG + Intergenic
1005452871 6:25991360-25991382 CTGAACACCTTACAAGAACCAGG - Intergenic
1006286705 6:33101567-33101589 CTGGGCACCTTGAAAAGAACAGG - Intergenic
1006349348 6:33509560-33509582 CTGGACAGCCCCCAAAACACAGG - Intergenic
1007514876 6:42403148-42403170 CTGGACATCTTCCCCAAAAAAGG + Intronic
1008320161 6:50102607-50102629 TTGGACAACTGCCAAAAAAGGGG - Intergenic
1010467237 6:76182937-76182959 ATGGACTCGTTCCAAAAAAGGGG - Intergenic
1011357618 6:86488964-86488986 CTGGGCACCTTGAAAAGAACAGG + Intergenic
1011398487 6:86935692-86935714 CTGAACATCTGCCAAAAAGCGGG + Intergenic
1012963588 6:105648438-105648460 CTTGACACCTTCAAAACCACAGG - Intergenic
1013109927 6:107056788-107056810 CTGAACACCCTCCAATATACAGG - Intergenic
1013812462 6:114060311-114060333 CTAGACAGCTTTTAAAAAACAGG + Intronic
1016156942 6:140822422-140822444 CTGGACACCTACCGGAAAGCAGG - Intergenic
1016493044 6:144628403-144628425 CTGCACACATTTCAAAAAAAAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018106219 6:160489433-160489455 CTGAAAACCTTCCAAAAATGAGG - Intergenic
1018106729 6:160494959-160494981 CTGAAAACCTTCCAAAAATGAGG - Intergenic
1018742985 6:166744460-166744482 CTGCACTCCTTTCAAAACACAGG + Intronic
1024335780 7:48203880-48203902 CTGGAAACATTTCAAGAAACTGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026396772 7:69963376-69963398 CTTAACACCTTCCAAGGAACCGG + Intronic
1027028183 7:74869710-74869732 CCAGTCACCTTCCATAAAACAGG + Intergenic
1031494280 7:122426954-122426976 CTGGATACCTTTTAGAAAACAGG + Intronic
1033684488 7:143625753-143625775 CTGGACAACTTCAAACAAACAGG - Intronic
1033687664 7:143704972-143704994 CTGGACAACTTCAAACAAACAGG - Intronic
1033700123 7:143831870-143831892 CTGGACAACTTCAAACAAACAGG + Intergenic
1033851623 7:145503360-145503382 CTCTACACTTTCCAAAAAAATGG - Intergenic
1033987910 7:147249163-147249185 CTGGAAATTTTCCAAAAAATGGG - Intronic
1037062998 8:14539449-14539471 CTGGGCAACTTCCAAACAAGAGG + Intronic
1039413819 8:37376996-37377018 CTGGAGCCCTTCCAAAGAGCAGG + Intergenic
1039447300 8:37643051-37643073 CTGCCCACCTTCCAAATAGCTGG + Intergenic
1039468340 8:37798692-37798714 CTGGACACAATCGAAAAGACTGG - Intronic
1041091391 8:54304445-54304467 CTGTGCAGCTTCCAAAATACTGG - Intergenic
1041414927 8:57597549-57597571 CTGGGCACCTTGAAAAGAACAGG + Intergenic
1042084438 8:65092428-65092450 CTGGGCACCTTGAAAAGAACAGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044407342 8:91843698-91843720 TTGGATACCTTCAATAAAACTGG - Intergenic
1046191360 8:110798961-110798983 CTGGGCACCTTGAAAAGAACAGG - Intergenic
1046321220 8:112578898-112578920 CTCGACACCTCCCTAAAATCAGG - Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050675335 9:8045843-8045865 CTGGGCACCTTGAAAAGAACAGG - Intergenic
1051342629 9:16125948-16125970 ATGGACACCATCCAAAATAATGG + Intergenic
1051397560 9:16641849-16641871 CTTGGCATCTTCCAAAAAAAGGG - Intronic
1052125953 9:24774634-24774656 CTGGGCACCTTGAAAAGAACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052969092 9:34365508-34365530 CTGGGCAAATTCCAACAAACTGG - Intergenic
1053593811 9:39539408-39539430 CTGTACACCTTTTAAAAATCTGG + Intergenic
1053851600 9:42294461-42294483 CTGTACACCTTTTAAAAATCTGG + Intergenic
1054572439 9:66825544-66825566 CTGTACACCTTTTAAAAATCTGG - Intergenic
1055581690 9:77712729-77712751 CTGGCCACCAGCCAAAAACCAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058564568 9:106268276-106268298 ATGTTCATCTTCCAAAAAACAGG + Intergenic
1058958554 9:109971448-109971470 TTGGACACCCTGCACAAAACAGG - Intronic
1062669734 9:137701059-137701081 CTGCACACTTTCCAACAACCAGG + Intronic
1062720224 9:138037701-138037723 CTGGAAGCCTTCCAAAAGAAGGG - Intronic
1186426566 X:9467342-9467364 CTGGACGCCCTGCAGAAAACTGG - Intronic
1190050151 X:47143662-47143684 TAGGACACCTTCTAAAAAATAGG - Intronic
1190619596 X:52272065-52272087 CTGGGCACCTTGAAAAGAACAGG + Intergenic
1191565631 X:62524526-62524548 CTGGATATCTTCACAAAAACTGG - Intergenic
1192369114 X:70498792-70498814 CAGGACACCTTCCAAAGGAGGGG + Intronic
1193252410 X:79307793-79307815 CAGGGCTCCTTCCAAAACACAGG - Intergenic
1196638007 X:118026044-118026066 CTGTATACATTCCAACAAACAGG + Intronic
1196820446 X:119696413-119696435 CGGGTCACCTTCCCAAGAACAGG + Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199339648 X:146661815-146661837 CTGGGCACCTTGAAAAGAACAGG + Intergenic
1199374716 X:147094146-147094168 CTGGATTTCTTCCTAAAAACTGG - Intergenic
1200299269 X:154956207-154956229 CTGGGCACCTTGAAAAGAACAGG - Intronic