ID: 921932425

View in Genome Browser
Species Human (GRCh38)
Location 1:220765550-220765572
Sequence GACTCTCTAGTGACTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921932425_921932428 27 Left 921932425 1:220765550-220765572 CCAGGCCCAGTCACTAGAGAGTC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 921932428 1:220765600-220765622 TCTCACTGTGTCACCCAGACTGG 0: 75
1: 3361
2: 41775
3: 98927
4: 184933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921932425 Original CRISPR GACTCTCTAGTGACTGGGCC TGG (reversed) Intronic
902400459 1:16154324-16154346 GTCTCTGGAGTGACAGGGCCCGG - Intronic
902930573 1:19728517-19728539 GACTCTCTGGGCACTGGGCAAGG + Intronic
903658213 1:24961661-24961683 GAATCTCTAGGGTTTGGGCCTGG - Intronic
906382586 1:45342214-45342236 GAATCACTAGTGACAGGGCTTGG + Intronic
907919494 1:58899284-58899306 GACATTCTGGCGACTGGGCCAGG + Intergenic
911097216 1:94064622-94064644 GAATCTCTAGTGGCAGGGCCAGG + Intronic
913538963 1:119800688-119800710 GACTTGCTAGTGAATGGGCATGG + Intronic
916844948 1:168641155-168641177 GAATCTCCAGTGTCTGGACCCGG - Intergenic
921932425 1:220765550-220765572 GACTCTCTAGTGACTGGGCCTGG - Intronic
923380281 1:233410883-233410905 CCCTCTCCAGTGACTGGGACTGG + Intergenic
1066371066 10:34818501-34818523 AACTTTCCAGTGACTGGGCTAGG + Intergenic
1068423243 10:56822671-56822693 CTCTCTCTGGTGTCTGGGCCTGG - Intergenic
1070156596 10:73839447-73839469 GCCTCCCTGGTGAGTGGGCCCGG + Intronic
1072258869 10:93647721-93647743 GACTCTCTGGAGTTTGGGCCTGG + Intronic
1072303157 10:94081804-94081826 GACTCTGAAGTTACTGGGACTGG - Intronic
1075067567 10:119299711-119299733 GACCATATAGTGACTGAGCCTGG + Intronic
1077495082 11:2883071-2883093 GCCTCTCTCCTGGCTGGGCCTGG - Intergenic
1080852372 11:36080879-36080901 GAGTCTCTAGTGAGTGTCCCTGG - Intronic
1083155300 11:60819151-60819173 GACTCTCTAGGGCAGGGGCCTGG - Intergenic
1085402352 11:76242464-76242486 GCCTCTGAAGTGACTGGGCTGGG + Intergenic
1086170092 11:83826256-83826278 CACACTCTGGTGGCTGGGCCAGG + Intronic
1089529317 11:119116325-119116347 GGATCTCCAGTGCCTGGGCCAGG + Exonic
1089555310 11:119312733-119312755 GACTCTCTGCTTACTGGGGCTGG - Intronic
1089816520 11:121181756-121181778 AATTCTCCAGTGACTGGGCATGG - Intronic
1090915215 11:131156972-131156994 AACTCTCTAATGTCTAGGCCAGG + Intergenic
1094112757 12:26878914-26878936 GTCTCCATGGTGACTGGGCCAGG - Intergenic
1094217818 12:27963405-27963427 GACTCTGGAGTGACTGGGAGTGG - Exonic
1097972037 12:65643799-65643821 GACTCTTTAGTTCCTGGGTCTGG - Intergenic
1102401491 12:112633459-112633481 GACTATCAAGGGACTGGGACTGG + Intronic
1103266923 12:119638528-119638550 GAATCTCCAGTAACAGGGCCAGG + Intronic
1103556259 12:121768554-121768576 AACTCTCTTGGGACTGGGCAGGG - Intronic
1104157704 12:126149453-126149475 GACTCTCTTGTGACTCTGCTGGG - Intergenic
1109110465 13:58312558-58312580 GACTATATGGTGACAGGGCCTGG - Intergenic
1112799654 13:103096442-103096464 GACACTCCAGCGACTGTGCCAGG - Intergenic
1113282522 13:108804810-108804832 GAGTCTCTAGTGAGTGAGCCAGG + Intronic
1113392321 13:109909489-109909511 GAATCTCCAGTGTCTGGGCCTGG - Intergenic
1113833204 13:113313063-113313085 GACTCCCTACTGGCTAGGCCTGG + Intronic
1118920477 14:70145505-70145527 GCATCTCTAGTGAGGGGGCCAGG - Intronic
1119128696 14:72152356-72152378 AACTGTCTAGTGAATGGTCCAGG + Intronic
1122073764 14:99222431-99222453 GTCTCTCCAGTGGCTGGGGCGGG - Intronic
1127868869 15:63053643-63053665 GAATCTCTAGGGACACGGCCTGG + Intronic
1128811943 15:70579411-70579433 GCATCTCTAGTGGCTGGGCATGG + Intergenic
1132006840 15:98235045-98235067 GACACTCTGGTGGCTGGACCTGG + Intergenic
1132557598 16:579439-579461 GCATCTCTAGTCTCTGGGCCCGG - Intronic
1134441771 16:14302839-14302861 GCCTCCCTAGTGCCTGGGCTTGG + Intergenic
1135039305 16:19105546-19105568 CACTCTCAAGGGACTGGACCAGG - Intergenic
1137550948 16:49437154-49437176 CACTCTCCAGAGAGTGGGCCTGG + Intergenic
1141484906 16:84332318-84332340 GCCTCCCTCGTGTCTGGGCCTGG - Intergenic
1145005325 17:19334245-19334267 CCTTCTCTAGTGCCTGGGCCTGG + Exonic
1145230365 17:21169521-21169543 GGCTGCCAAGTGACTGGGCCAGG + Intronic
1149599014 17:57881440-57881462 GACTCTCTGGTGCCTGGCACAGG + Intronic
1149741399 17:59049612-59049634 GCCTCTCAAGTGGCTGGGACTGG + Intronic
1151564966 17:74892896-74892918 GACTCTCCAGTGCGTGGTCCTGG + Intronic
1151969507 17:77450582-77450604 GACACTATAGGGGCTGGGCCTGG - Intronic
1156779666 18:40836288-40836310 TACTCTCTAGTGACTGATTCAGG - Intergenic
1157880204 18:51314345-51314367 GATTCTCTGGGGACAGGGCCAGG - Intergenic
1158670331 18:59468507-59468529 GACTCCCAAGTGAATGGGGCAGG - Intronic
1163366749 19:16879787-16879809 GAATCCCAAGTGACTGGGGCTGG + Exonic
1165108723 19:33489018-33489040 GACTGGCTGGTGACTGGCCCTGG - Intronic
1168348727 19:55663659-55663681 GGATCTTTAGTGACTGGCCCTGG - Exonic
926168253 2:10534913-10534935 GCCTCCCGTGTGACTGGGCCAGG + Intergenic
929962461 2:46506950-46506972 GGCTCTGGAGGGACTGGGCCTGG - Intronic
937987263 2:127643598-127643620 GACTCTGTAGTGACAGTTCCTGG - Intronic
940909303 2:159196179-159196201 CACTCTCTGGTCACTGAGCCAGG - Intronic
942786623 2:179708644-179708666 GACTCTCTAAACAATGGGCCTGG + Intronic
944050826 2:195467597-195467619 GACTCTAAATTGGCTGGGCCCGG - Intergenic
944149095 2:196538314-196538336 GAATCTCTTGGGACAGGGCCTGG - Intronic
944524328 2:200602778-200602800 GACTATATGGTGACTGGACCCGG - Intronic
947637460 2:231687416-231687438 AACCCTCCAGTGGCTGGGCCTGG - Intergenic
1168785707 20:538290-538312 GATTCTCTATTGGCTGGACCAGG + Intronic
1169794084 20:9442708-9442730 GTCTCTCTAGTGACTGAGGCAGG - Intronic
1170647993 20:18213651-18213673 GACTGTTTTGTGACTGTGCCCGG - Intergenic
1170940643 20:20845485-20845507 CTCTCCCTAGAGACTGGGCCTGG - Intergenic
1171405596 20:24910498-24910520 CACTCTCTGGGGACTTGGCCAGG + Intergenic
1173245661 20:41335747-41335769 GCATCTCTAGTGCCTGGCCCAGG + Intergenic
1174549228 20:51349718-51349740 GACTCTTTAATGAGTGGCCCTGG - Intergenic
1177655502 21:24011351-24011373 GACTCCCTCCTGAGTGGGCCTGG - Intergenic
1182428020 22:30285108-30285130 GACTTTGTAGTGACTGGGTTGGG - Exonic
1182521095 22:30884877-30884899 GTCTCTCCAGCGACTGTGCCAGG - Intronic
1183370901 22:37431635-37431657 GTCTTTCTAGTGACGTGGCCAGG - Intergenic
1183974066 22:41500188-41500210 GATTCTCCAGGCACTGGGCCTGG - Intronic
949880640 3:8658040-8658062 CACTCTGCAGTGAATGGGCCTGG + Intronic
954426835 3:50447792-50447814 GGCTCTGTGGTGACTGGGGCAGG - Intronic
954696362 3:52429332-52429354 GTCTCCCTAGTGACTAAGCCAGG + Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955934410 3:64089016-64089038 GACTCTCTAGGGATGGGGCTGGG + Intergenic
964528522 3:157642196-157642218 ATCTCTATAGTGACTGTGCCTGG - Intronic
968638158 4:1693952-1693974 GAGTCACTAGTCACTGTGCCTGG + Intronic
976045936 4:80947563-80947585 GAATCTCTAAAAACTGGGCCTGG - Intronic
977786395 4:101039637-101039659 TACTCTTTAGTGACTGTACCAGG + Intronic
981579028 4:146233739-146233761 GGCCTTCAAGTGACTGGGCCAGG - Intergenic
985029856 4:185778610-185778632 GACTCTCTAGGGGCGGGGCCGGG - Intronic
986403908 5:7406508-7406530 CAATCTCTAGTCTCTGGGCCAGG - Intronic
987063812 5:14268470-14268492 GTCTCTCTAGTGTCGGAGCCAGG + Intronic
992123860 5:73621733-73621755 GAATCTCTAGAGACTGGCTCTGG + Intergenic
997419070 5:133751573-133751595 GTCTCTCTAATGACTGGCCATGG - Intergenic
998252123 5:140560514-140560536 GGCCCTCTAGTGACTAGGCCTGG - Intronic
998822257 5:146067527-146067549 GACTCTCTAGGGCCCAGGCCAGG - Intronic
1002432264 5:179210538-179210560 GTCTCTCTAGGCACTGGTCCTGG - Intronic
1002980076 6:2127624-2127646 GCCTCTCGAGTGATAGGGCCTGG + Intronic
1015484617 6:133754513-133754535 GACTATCCAGTGCCTGGCCCTGG - Intergenic
1017182387 6:151565374-151565396 GGCTCTCTGGTGGCTGGGACTGG + Intronic
1029099265 7:98114904-98114926 GAATCTCTAAGGGCTGGGCCAGG - Intronic
1035667945 8:1392667-1392689 GCATCTCTGGGGACTGGGCCAGG + Intergenic
1040537095 8:48319933-48319955 GACTCTCCTGTGGCTGGGCTTGG + Intergenic
1044761282 8:95520315-95520337 GAATCCCTAGTGACTGGTCCAGG + Intergenic
1047508047 8:125495363-125495385 GACTCTGAAGTGGCTGAGCCAGG - Intergenic
1047571252 8:126100758-126100780 CACTGTGTAGTGAGTGGGCCTGG + Intergenic
1049407879 8:142459856-142459878 GCCTGTGTAGTGTCTGGGCCAGG - Intronic
1055077043 9:72226820-72226842 AATTCTGTAGTCACTGGGCCGGG + Intronic
1056427915 9:86496752-86496774 AATTCGCTAGTGACTGAGCCTGG + Intergenic
1059033281 9:110724473-110724495 GACGGTTTAGTGACTGGGTCTGG - Intronic
1060711908 9:125875098-125875120 GAAACTCTAGTGCATGGGCCAGG - Intronic
1061014742 9:127975167-127975189 GCCTCCCCAGGGACTGGGCCTGG + Intronic
1189376880 X:40473544-40473566 GGCTGTCTAGTGGCTGGCCCTGG - Intergenic
1189417432 X:40827603-40827625 GTTTCTCTAATGCCTGGGCCTGG - Intergenic
1197092889 X:122559426-122559448 AACCCTCCAGTGACTGGGACAGG - Intergenic
1198637926 X:138720510-138720532 GCCTCTCCAGTGACTGTCCCTGG + Intronic
1201566993 Y:15375694-15375716 GATTCCCTAGTCACTGGCCCAGG + Intergenic
1201567028 Y:15375898-15375920 GATTCCCTGGTGACTGGCCCAGG + Intergenic