ID: 921932907

View in Genome Browser
Species Human (GRCh38)
Location 1:220769708-220769730
Sequence CAGGGAGTTAAACAACTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921932907_921932914 26 Left 921932907 1:220769708-220769730 CCCTCAAGTTGTTTAACTCCCTG 0: 1
1: 0
2: 2
3: 9
4: 140
Right 921932914 1:220769757-220769779 TCTCTCTGTGTATGTGTGGTCGG 0: 1
1: 2
2: 12
3: 136
4: 1222
921932907_921932913 22 Left 921932907 1:220769708-220769730 CCCTCAAGTTGTTTAACTCCCTG 0: 1
1: 0
2: 2
3: 9
4: 140
Right 921932913 1:220769753-220769775 TCTTTCTCTCTGTGTATGTGTGG 0: 1
1: 0
2: 25
3: 126
4: 905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921932907 Original CRISPR CAGGGAGTTAAACAACTTGA GGG (reversed) Intronic
906877169 1:49552007-49552029 GATGGAGTTACACAACTTCATGG + Intronic
910490099 1:87759574-87759596 CCGGAAGTGAAACAACTTTATGG - Intergenic
911931070 1:103904126-103904148 GAGGGATTTGAACAACTAGATGG - Intergenic
914194868 1:145441930-145441952 CAGGGAGGGAAACAGCCTGAGGG - Intergenic
914476142 1:148024497-148024519 CAGGGAGGGAAACAGCCTGAGGG - Intergenic
915856593 1:159395151-159395173 CAGGGAGATAAACAACTGGATGG - Intergenic
916622808 1:166519304-166519326 CTGGGAGTAAGACAGCTTGAGGG + Intergenic
916838855 1:168578927-168578949 CAGAAAGTTAACCAGCTTGATGG + Intronic
917050270 1:170914765-170914787 CAGTGAATTATAGAACTTGAGGG + Intergenic
921641281 1:217557992-217558014 CAGGGGGTTAAAAAAATTAATGG - Intronic
921932907 1:220769708-220769730 CAGGGAGTTAAACAACTTGAGGG - Intronic
924096893 1:240561334-240561356 AAGGGAGTTAAAAGACGTGAAGG + Intronic
1063840144 10:10062460-10062482 CGGGGAGAGAAAAAACTTGATGG - Intergenic
1064480196 10:15733091-15733113 GATGGAGTTAAGCAACTTGCAGG + Intergenic
1065284883 10:24177712-24177734 CAAGCAGTTAGACAAATTGAAGG + Intronic
1068713831 10:60164653-60164675 CAGGAAGTTCAATAACATGAAGG + Intronic
1075337614 10:121619657-121619679 CAGGGAGACCAACAACCTGAGGG + Intergenic
1078708534 11:13768168-13768190 CAGGCAGTTATACAAATAGATGG - Intergenic
1080980797 11:37403220-37403242 CAGGAAGTGAAATAATTTGAAGG + Intergenic
1083076110 11:60040582-60040604 CAGGGAGTAAAACACCTGCATGG - Intronic
1083600167 11:63942226-63942248 CAGAGAGTTAAGGAACTTGCAGG - Intronic
1085650586 11:78264637-78264659 AAGGGAGATAAACCACCTGAGGG - Intronic
1086080190 11:82896122-82896144 TAGGAGTTTAAACAACTTGATGG - Intronic
1086996833 11:93367956-93367978 CCAGGCTTTAAACAACTTGAGGG - Intronic
1087221481 11:95551101-95551123 CAGGGAGGGACACAACCTGAAGG + Intergenic
1088171784 11:107006186-107006208 CAGAGAGTTAAAGAACCTGAAGG + Intronic
1089279689 11:117365016-117365038 CAGGGAACTAAACAGATTGAAGG - Intronic
1090478087 11:127042671-127042693 CAATGAGTTAAACATATTGATGG + Intergenic
1090844533 11:130519756-130519778 CAGGGGGTTATGCAACCTGAAGG + Intergenic
1091869305 12:3873991-3874013 CATGGTTTTAAACATCTTGAGGG - Intergenic
1092273407 12:7040804-7040826 CAGGGAGTTAACCACCATAAGGG + Intronic
1092839141 12:12522208-12522230 CAGGGCCTTAAGCAACTTGGTGG - Intronic
1094821338 12:34228216-34228238 CAGGGTGGAAAACCACTTGAAGG + Intergenic
1096788999 12:54033812-54033834 GAGGGAGTTAAAAAAATAGAGGG + Intronic
1096856127 12:54484813-54484835 CTGCCAGCTAAACAACTTGAAGG - Intergenic
1098240037 12:68457649-68457671 TAAGGAGTTAAACAACTCTATGG + Intergenic
1102212793 12:111139098-111139120 CAGGGAGTTTAACAACCTGCTGG - Intronic
1102616431 12:114158599-114158621 GAATGAATTAAACAACTTGAAGG - Intergenic
1105805876 13:23951355-23951377 CAGGGAGCTGAAGAACATGATGG - Intergenic
1106615941 13:31327808-31327830 CAGGGAGTTAAAAATCTAAAAGG - Intronic
1112196628 13:97232905-97232927 AATGAACTTAAACAACTTGATGG + Intronic
1118002004 14:61531918-61531940 CAGGAAGTTAAGAAACTTCATGG - Intronic
1118811824 14:69280825-69280847 CAGGGAGCTATACAACCTGGAGG - Intronic
1119199402 14:72741756-72741778 CTGGGAGGTGGACAACTTGACGG - Intronic
1120026616 14:79592964-79592986 CAGAAAGTTAAAGTACTTGATGG - Intronic
1120568181 14:86085461-86085483 CAGGATGTTACACAACTTGGGGG - Intergenic
1121088539 14:91165088-91165110 CAGTGAGTGAAAGAACTAGAAGG - Intronic
1121745071 14:96282328-96282350 AAGGAACTTAAAGAACTTGATGG + Exonic
1122963167 14:105108655-105108677 CAGGGATTTTATCAACTAGAAGG + Intergenic
1123973551 15:25531270-25531292 AAGGGAGCAAAACAGCTTGATGG + Intergenic
1124207031 15:27729957-27729979 CAGAGAGTTAAATAATTTGTTGG - Intergenic
1125903936 15:43372806-43372828 AAGGGAAATAAACAAGTTGATGG - Intronic
1127462148 15:59209055-59209077 CAGGGAGTTAAACAGCTTTTTGG - Intronic
1131085937 15:89575723-89575745 CTGCGAGTCAAAGAACTTGAAGG - Exonic
1133720394 16:8489267-8489289 CAGGGAGTTAAGAAAAATGAAGG - Intergenic
1134338402 16:13322837-13322859 GTGGGAGTTAAACAACTTTACGG - Intergenic
1134599031 16:15518913-15518935 CATGGAGTTTATAAACTTGAAGG - Intronic
1139832852 16:69814097-69814119 CAGTAAGCTAAACCACTTGAGGG + Intronic
1140116107 16:72042943-72042965 AAGGGAGTAAAAGAACATGAAGG - Intergenic
1140146683 16:72318093-72318115 GAAGGAGTTAGAAAACTTGAAGG + Intergenic
1143887295 17:10074508-10074530 CAGGGAGTTCCAGAACTTGGGGG - Intronic
1146524194 17:33552132-33552154 CAGAGAGTTAACGAATTTGAAGG + Intronic
1149480182 17:56997065-56997087 CAGGGACTTTAATAACTTCAAGG - Intronic
1151035236 17:70791567-70791589 CAAAGAGTTAAATAATTTGAGGG + Intergenic
1156702180 18:39839340-39839362 CAGGTAGATAAACATTTTGATGG + Intergenic
1156748213 18:40418305-40418327 AAAGGTGTTGAACAACTTGATGG - Intergenic
1157404107 18:47409226-47409248 AAGGGAGTTAAAAAAATAGAAGG + Intergenic
1159619076 18:70616911-70616933 CAGGGGGTTAATGAACTTCAGGG + Intergenic
1160144121 18:76350056-76350078 CAGAGAGTTAGAAAACTTGAAGG - Intergenic
1161756857 19:6140252-6140274 CTGAGAATTAAACAACCTGAAGG + Intronic
1163423619 19:17228733-17228755 CAGAGAGTTAAGCAGCTTGAAGG + Intronic
926758080 2:16251962-16251984 CAGGGAGGTAAAGAAGTTCAAGG + Intergenic
927400197 2:22702609-22702631 CAGGCATTTAAATAACTTGATGG + Intergenic
929284175 2:40116856-40116878 CAGTGACTTAAACTTCTTGATGG + Intronic
930102948 2:47617293-47617315 GAGGGAGGCAAACAAGTTGAGGG - Intergenic
933437776 2:82270528-82270550 AAGTGAGTTACATAACTTGAGGG + Intergenic
935831102 2:107001442-107001464 CAGGAAATTTACCAACTTGATGG + Intergenic
938166328 2:129030090-129030112 CCTGGAGTTAAACAACTTTGTGG - Intergenic
943409614 2:187530599-187530621 CAGAGCGTAAAATAACTTGATGG + Intronic
944428171 2:199605188-199605210 CAGGGAATTCAGCAACTTGCTGG + Intergenic
945307220 2:208269721-208269743 CACTCAGTTAAACAGCTTGAAGG + Intronic
1169850301 20:10041824-10041846 AAGTGACTTAAACTACTTGATGG - Intronic
1172213403 20:33216706-33216728 CTGGGAGTAGAACAACTAGATGG + Intergenic
1173365182 20:42378744-42378766 CAGGAAGTTAAATAATTTGCAGG - Intronic
1173746525 20:45441646-45441668 TAGTGAGTTATCCAACTTGAGGG + Intergenic
1175126117 20:56752708-56752730 CAGGGAGATACAATACTTGAGGG + Intergenic
1175732975 20:61366701-61366723 CAGGGCGGAAAACCACTTGAAGG - Intronic
1177206314 21:18015583-18015605 CAGAGGGTTGAACAACTTGAGGG + Intronic
1178027974 21:28489706-28489728 CAGTGAGTTGAATACCTTGAAGG + Intergenic
1178310943 21:31529570-31529592 CAGGGAGTTTAAGACCTTGTGGG + Intronic
949466050 3:4344828-4344850 GAGGAACATAAACAACTTGATGG + Intronic
950536899 3:13584013-13584035 CTGGGAGTGAAACAGCTTGTTGG + Intronic
953499478 3:43419200-43419222 CAGGTCATTAAACAACATGATGG - Intronic
954499789 3:51001024-51001046 CAGGTAGATAAACAAATTGTGGG - Intronic
955913064 3:63878201-63878223 CAGGCAGTGATACAACTTGTTGG + Intronic
956469244 3:69548403-69548425 CAAGAAATTATACAACTTGAAGG + Intergenic
957588822 3:82168990-82169012 AAGGAAGTCAAACAACTTCATGG + Intergenic
961487361 3:127226548-127226570 GAGGGAGAGAAACAACTTGCAGG - Intergenic
963119522 3:141764407-141764429 CAGTGAATTTAACAACTTGGAGG - Intergenic
966212930 3:177471365-177471387 CAGGAAGTGAATCACCTTGATGG + Intergenic
967870540 3:194225451-194225473 CAAGGAGTAAAACAAAGTGAGGG + Intergenic
970539125 4:17059821-17059843 TAGGGATTTAAATAACATGATGG + Intergenic
971516999 4:27499609-27499631 CAGGGATGAAATCAACTTGATGG - Intergenic
972755916 4:42045874-42045896 CAGGGATGAAACCAACTTGATGG - Intronic
977193887 4:94034406-94034428 CAGGGAGATAAAGACCTAGAAGG - Intergenic
977800124 4:101218095-101218117 CAGGGTCTTAATAAACTTGATGG + Intronic
979986440 4:127321715-127321737 CACGGTGTTAGACAACATGAAGG + Intergenic
983093448 4:163534536-163534558 CATGGAGTTAAACTCTTTGAAGG + Intronic
984144732 4:176046431-176046453 CAGTGAGTTAGACTTCTTGAAGG + Intergenic
984625965 4:182008580-182008602 GAGGAACATAAACAACTTGATGG - Intergenic
986022676 5:3819661-3819683 CAGGGAGATAAAAAGCTGGAAGG + Intergenic
986370791 5:7078138-7078160 CAGAGAGTGAAACAACTTTGTGG + Intergenic
987310271 5:16675089-16675111 CAGGGAATTGAATATCTTGATGG + Exonic
990306479 5:54498550-54498572 CAGGGCGGAAAACAACTTAAAGG - Intergenic
993558398 5:89371087-89371109 CAGAGAGTAGAACAACATGAGGG + Intergenic
993793387 5:92235415-92235437 CTGGAAATTAAACAACCTGAAGG - Intergenic
993839178 5:92855187-92855209 CAGGGAGTTAAACATTCTGATGG + Intergenic
994762533 5:103874380-103874402 CAGAAAGTTAATCAATTTGAAGG + Intergenic
995562748 5:113400764-113400786 CAGGTACTTAAACAGCTTGGTGG + Intronic
1001637945 5:173226131-173226153 CAGGGAGACAACCAGCTTGATGG + Intergenic
1001894463 5:175366538-175366560 CAGTGAGTTAAACAAGATCATGG + Intergenic
1002397334 5:178968292-178968314 CAGGGGGTTGCTCAACTTGACGG - Intergenic
1002676296 5:180916072-180916094 CATGGAATTACACAACTAGAAGG - Intronic
1005209662 6:23446060-23446082 CAGGGAGTAGAATAACTGGAAGG - Intergenic
1007906651 6:45468013-45468035 CAGAGAGTTTCACAACATGAAGG - Intronic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1011572546 6:88754720-88754742 CAGGGAGGAAAACCACTTAAAGG + Intronic
1011683825 6:89808312-89808334 CAGGCAGTTAATCAGCTTGTAGG + Intronic
1011862705 6:91780571-91780593 AAGGGAGTGAAAGAAGTTGAGGG - Intergenic
1012985090 6:105867228-105867250 CAGGATGGTGAACAACTTGAAGG - Intergenic
1013149833 6:107433903-107433925 AAGGGGCTCAAACAACTTGAAGG + Intronic
1013771870 6:113637049-113637071 CTGGCAGGTAATCAACTTGAGGG - Intergenic
1017869837 6:158478073-158478095 CAGGAAGGGGAACAACTTGAGGG + Intronic
1021789787 7:24193319-24193341 CAGGGACTTAAGAAATTTGAGGG - Intergenic
1026265442 7:68792212-68792234 ATGGGAATTAAACAACTTAAGGG - Intergenic
1031227714 7:119061608-119061630 CAAGGACCTAAACATCTTGATGG + Intergenic
1031414037 7:121474278-121474300 AAGGCAGTTAAGAAACTTGATGG - Intergenic
1031441635 7:121801576-121801598 AAGGGAGATAAATAACTTAAAGG - Intergenic
1031670826 7:124542607-124542629 CATGGGGTTAAAAAATTTGATGG + Intergenic
1037646452 8:20796735-20796757 CAGGGAGTTAAGGAGTTTGAAGG + Intergenic
1044375487 8:91465290-91465312 CATGGGGTTTAACACCTTGAAGG - Intergenic
1045917336 8:107487579-107487601 CAGAGAGCTAAAGAAATTGATGG + Intronic
1046340319 8:112845784-112845806 GAGGGAGTTAAACAACTTCAAGG + Intronic
1048294137 8:133202225-133202247 CAGGGAGGTGAAGAACTTAAGGG - Intronic
1052850470 9:33375364-33375386 CAGCGCGCTATACAACTTGAAGG + Intergenic
1055210659 9:73786833-73786855 CAGGGATGCAACCAACTTGATGG - Intergenic
1058067151 9:100562389-100562411 CAGGGAGCTAAAGAAGTAGAAGG - Intronic
1185959738 X:4536221-4536243 CAGGGAGTTGTGCAACTTGGGGG + Intergenic
1189168558 X:38886383-38886405 CAGAGAGTTCTACAACTTGTGGG - Intergenic
1192167526 X:68835163-68835185 CAGGGAGTAAAAGGACTTGGGGG - Intronic
1194897537 X:99463411-99463433 GATGAAGTTACACAACTTGATGG + Intergenic
1197813609 X:130473843-130473865 CAGGGACATTAACAAGTTGATGG + Intergenic