ID: 921933923

View in Genome Browser
Species Human (GRCh38)
Location 1:220778492-220778514
Sequence ATGGTTTAGCACCACCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1921
Summary {0: 3, 1: 17, 2: 181, 3: 606, 4: 1114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921933923_921933930 20 Left 921933923 1:220778492-220778514 CCAAGGTGGTGGTGCTAAACCAT 0: 3
1: 17
2: 181
3: 606
4: 1114
Right 921933930 1:220778535-220778557 TGATTGAATTCTGTCCCGCCAGG 0: 1
1: 0
2: 0
3: 58
4: 1067

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921933923 Original CRISPR ATGGTTTAGCACCACCACCT TGG (reversed) Intronic
900673861 1:3871963-3871985 AGGGTCTAGCACCATCGCCTGGG - Intronic
900713033 1:4127077-4127099 AGGGTTTAGCACCATCCTCTTGG + Intergenic
900746492 1:4364253-4364275 ATGGTTTAGCACCATGCACTTGG + Intergenic
900877891 1:5358778-5358800 ATGGTTTAACACCACCTCCTTGG + Intergenic
900902931 1:5528897-5528919 GTGGTTTAGCACCATCCTCTTGG + Intergenic
900903184 1:5530922-5530944 ATGGTTTAGCACCATCACCTTGG + Intergenic
901364621 1:8735690-8735712 ATGGTTTAGCACCATCCCCTCGG + Intronic
901744752 1:11364804-11364826 ATGGTTTAGCACCATCCTCTTGG + Intergenic
901906831 1:12419650-12419672 ATGGATTAGTACCATCCCCTTGG - Intronic
902115827 1:14120350-14120372 ATGGTTTAGCATCATCCTCTTGG - Intergenic
902200601 1:14830733-14830755 ATGGTTTGGCACCATCCCCCTGG - Intronic
902246107 1:15121730-15121752 GTGGTTTAGCACCATCCTCTTGG + Intergenic
902322575 1:15678819-15678841 ATGGTTGAGCACCATCCTCTTGG - Intergenic
902540838 1:17153307-17153329 ATGGTTTAGCACCATTCCTTTGG + Intergenic
902792782 1:18780420-18780442 ATGGCTTAGGACCATCCCCTTGG - Intergenic
903026490 1:20433266-20433288 ATGGTGTAGCACCATCCCTTTGG + Intergenic
903298188 1:22359195-22359217 ATGGCTTAGCGCCATCCCCTTGG + Intergenic
903998699 1:27324883-27324905 ATGGTTCAGCACCATCCCTTTGG - Intronic
904386357 1:30144979-30145001 GTGGTTTAGCACCATCTCCTTGG - Intergenic
904387482 1:30153159-30153181 ATGGTTTAGCCCCATCCCTTTGG + Intergenic
904456029 1:30648706-30648728 ATGGTTTAGCATAATCCCCTTGG + Intergenic
904887528 1:33752288-33752310 ATGGCTTAGCGCCATCCCCTTGG + Intronic
905603171 1:39271409-39271431 ATGGTTTAGCACCATCCCCTTGG - Intronic
905648935 1:39643749-39643771 ATGGTTTAGTCCCATCCCCTTGG + Intergenic
905776578 1:40671493-40671515 ATGGTTTAGCACCATCCCCTTGG + Intergenic
905813692 1:40931573-40931595 ATGGTTTAGCACCATTCCCTTGG - Intergenic
906375605 1:45294211-45294233 ATGGTTTGGCACCATCCTCTTGG + Intronic
906394378 1:45448655-45448677 ATGGTTTAGTACCATCCCGTCGG - Intronic
906570663 1:46835661-46835683 ATGGTTTAGCGCCATCTACTTGG - Intergenic
906857657 1:49325784-49325806 ATGGTTTAGCACCATCGTCTTGG + Intronic
906891304 1:49718188-49718210 ATGGTTTAGCATTATCCCCTTGG + Intronic
907009345 1:50948884-50948906 ATGGCTTAGCACCATCCCCTTGG - Intronic
907195590 1:52684015-52684037 ATGGTTTAGGACCCTCCCCTTGG + Intergenic
907223297 1:52922861-52922883 ATGGTTTAGCACCATCCCCTTGG - Intronic
907294642 1:53442491-53442513 ATGAGTTAGCACCATCCCCTCGG + Intergenic
907622125 1:55992184-55992206 ATGGTTTAGTACTATCCCCTTGG - Intergenic
907625664 1:56026824-56026846 ATGGTTTAGCACCATCCCTTTGG + Intergenic
907984658 1:59518583-59518605 ATGGTTTCGCATCATCCCCTTGG + Intronic
908076751 1:60528193-60528215 ATGGTTTGACACCATCCCCTTGG + Intergenic
908263363 1:62355692-62355714 ATGTTTTAGTACCATCCCCTGGG - Intergenic
908395926 1:63725634-63725656 ATAGTTTAGCACCATCCCGTTGG - Intergenic
908454877 1:64293920-64293942 ATGGTTTAGCACCACCCACTTGG - Intergenic
908539887 1:65112273-65112295 ATGATTTAACACCATCCCCTTGG - Intergenic
908580603 1:65512221-65512243 ATAGTTTAGCACCATCCCCTTGG - Intronic
908646922 1:66288285-66288307 ATGGTTTAGCACCATTCCCTTGG - Intronic
908675473 1:66598741-66598763 ATGGTTTAGCACCATCTCTTCGG - Intronic
908880791 1:68730228-68730250 ATGGGTTAGCACCATCCCCTAGG + Intergenic
909230979 1:73089664-73089686 ATAGTTTAGCACCATCCACTTGG + Intergenic
909241057 1:73213454-73213476 TTGGTTTAGTACCATCCCCTTGG - Intergenic
909252917 1:73381231-73381253 ATGATTTAGCACCATCCGCTTGG + Intergenic
909258046 1:73449347-73449369 ATGGTTTAGCACCATCCTCCTGG - Intergenic
909340693 1:74527980-74528002 ATACTTAAGCACTACCACCTTGG - Intronic
909491053 1:76226769-76226791 ATAGTTTAGTACCATCCCCTTGG - Intronic
909529965 1:76671204-76671226 ATGGTTTGGCACCATCCCCTTGG - Intergenic
909531955 1:76691936-76691958 ATGGTTTAGCACCATCCCTTTGG - Intergenic
909684275 1:78329085-78329107 ATGCTATAGCCCGACCACCTTGG + Intronic
909700113 1:78512792-78512814 ATGGTTTAGCACCAACTCCTTGG + Intronic
909773656 1:79457618-79457640 ATGGTTTAGCACCATCCTCTCGG + Intergenic
909860745 1:80602342-80602364 ATGGTTTAGCCCCATCCCCTTGG - Intergenic
910255227 1:85241276-85241298 ATCGTTTAGTACCATCCCCTTGG + Intergenic
910273390 1:85421110-85421132 ATGGTTTAGCACCATCTCCTTGG - Intronic
910329733 1:86057118-86057140 ATGGTTTAGCATCATCTCCTTGG + Intronic
910350459 1:86291013-86291035 ATGGTTTAGTACCATCCCGTTGG + Intergenic
910395245 1:86786836-86786858 ATGGCTTAGCACCATCCCCTTGG + Intergenic
910402648 1:86852760-86852782 ATGGTTTAGCACCATCCCCTTGG - Intergenic
910423778 1:87099469-87099491 ATGGTTTAGTGCCATCCCCTTGG - Intronic
910424213 1:87102418-87102440 ATGGTTTAGCACCATCCCCTTGG - Intronic
910481208 1:87660392-87660414 ATGGTTTAGCACCATCCTCTTGG - Intergenic
910509091 1:87983747-87983769 ATGGCTTAGCACAATCCCCTTGG + Intergenic
910740739 1:90513577-90513599 ATGGCTTAGCACCATCCCCTTGG + Intergenic
910833835 1:91487417-91487439 ATGGTTTAGCCTCATCCCCTAGG - Intergenic
910849915 1:91639853-91639875 ATAGTTTAGCACCATCCCATTGG + Intergenic
910975116 1:92898360-92898382 ATGGCTTAGCACCATCCCCTTGG - Intronic
911249915 1:95563773-95563795 ATGGTTTAGCACCGCCCACTTGG - Intergenic
911273896 1:95838038-95838060 ATGGTTTTGCACCATCCCTTTGG - Intergenic
911339980 1:96624110-96624132 ATGGTTCAGCACCATCCTCTTGG + Intergenic
911488203 1:98528499-98528521 GTGGTTTAGCACCACACCCATGG + Intergenic
911512876 1:98828497-98828519 ATGGTTTAGCACTATCCCCTTGG + Intergenic
911529128 1:99022885-99022907 ATGGTTTAGCACCTTCCCCTTGG + Intergenic
911534753 1:99087528-99087550 ATGGTTTAGCACTCTCCCCTTGG + Intergenic
911788466 1:101980673-101980695 ATGGACTAACACAACCACCTAGG + Intronic
911805304 1:102200049-102200071 ATGGTTTAGAACCACCACTTTGG - Intergenic
911811208 1:102284398-102284420 ATGGTTTAGCACCACCCCTTTGG - Intergenic
911814177 1:102322894-102322916 AGGGCTTAACACCATCACCTGGG - Intergenic
911885275 1:103289711-103289733 ATGGTTTAGCACCATCTCCTTGG + Intergenic
911886070 1:103301135-103301157 ACGGTTTAGCACCATCCCTTTGG - Intergenic
911922545 1:103784035-103784057 GTGGTTTAGCACCATCCTCTTGG - Intergenic
911962679 1:104326584-104326606 ACTGTTTAGCACCATCCCCTTGG - Intergenic
912014593 1:105017342-105017364 ATGGCTTAGCACCATTTCCTTGG - Intergenic
912102804 1:106232823-106232845 ATGGTTTAGCACTGTCCCCTTGG + Intergenic
912108054 1:106305499-106305521 GTGGTTTAGCACCATCCCCTGGG - Intergenic
912109666 1:106325698-106325720 ATGTTGTAGCACCATCCCCTTGG + Intergenic
912260835 1:108110578-108110600 ATGGTTCAGCACCATCCCCTTGG - Intergenic
913051335 1:115119406-115119428 ATGGTTTAGCATCATCCCATTGG - Intergenic
913051612 1:115121448-115121470 AGGGTTTAGCATCATCCCCTTGG - Intergenic
913052842 1:115132090-115132112 ATGGCTTAGCACCATCCTCTTGG - Intergenic
913139917 1:115930945-115930967 ATGATTTAGCACGATCTCCTTGG + Intergenic
913330331 1:117661904-117661926 ATGGTTTAACACCATCCCTTTGG + Intergenic
913330606 1:117663952-117663974 ATGGTTTAGCACCTTCCCCTTGG + Intergenic
913377361 1:118167844-118167866 ATGGTTTAGAACCATCCTCTGGG + Intronic
913380205 1:118202339-118202361 GTGGTTTAGTACCATCGCCTTGG - Intergenic
913388960 1:118289587-118289609 ATGGTTTAGTGCCATCCCCTTGG - Intergenic
913478093 1:119258470-119258492 ATGGCTTAACACCATCCCCTTGG + Intergenic
913566762 1:120080312-120080334 ATGGCTTAGCGCCATCCCCTTGG + Intergenic
913631370 1:120713240-120713262 ATGGCTTAGCGCCATCCCCTTGG - Intergenic
913693330 1:121300437-121300459 ATGGTTTAGCACCATCTCTGTGG - Intronic
914144226 1:144979643-144979665 ATGGTTTAGCACCATCTCTGTGG + Intronic
914287517 1:146241019-146241041 ATGGCTTAGCGCCATCCCCTTGG + Intergenic
914548549 1:148691761-148691783 ATGGCTTAGCGCCATCCCCTTGG + Intergenic
914618129 1:149379950-149379972 ATGGCTTAGCGCCATCCCCTTGG - Intergenic
914904922 1:151736128-151736150 ATGGTTTAGCACCATCCCCTTGG + Intergenic
914905243 1:151738451-151738473 ATGGTTTAGCACCATCCCCTTGG + Intergenic
914967286 1:152271348-152271370 ATGGTTTAGCACCATCTTCTTGG - Intergenic
914969082 1:152290765-152290787 ATGGTTTAGCACCATCTTCTTGG + Intergenic
915504837 1:156347690-156347712 ATGTCTTAGCACCATCCCCTTGG - Intronic
915649733 1:157301077-157301099 ATGGTTTAGCACCATTCCCTCGG - Intergenic
915653390 1:157336348-157336370 ATGGTTTATCACCATTTCCTTGG + Intergenic
915668331 1:157465251-157465273 ATGGTTTAACACTATCCCCTTGG + Intergenic
915684180 1:157615173-157615195 ATGGTTTACTACCATCCCCTTGG - Intergenic
915855788 1:159384903-159384925 ATGGTTTAGTACCATCTTCTTGG + Intergenic
915874910 1:159602177-159602199 ATGGTTTAGTACCATCCTCTTGG + Intergenic
916218258 1:162417481-162417503 ATGGGTTAGCACCATCCCTTCGG - Intergenic
916343805 1:163765935-163765957 ATGGTCTAGCACCATCCCATTGG - Intergenic
916466841 1:165081468-165081490 ATGGTTTAACACCATCCTCTTGG - Intergenic
916649453 1:166821237-166821259 ATGGTTTAGCACCATCTCCTTGG - Intergenic
916693908 1:167218076-167218098 ATGGTTTAGCACCATCGCCTTGG + Intergenic
916735895 1:167606754-167606776 ATGGTTTAGCGCCATCCACTTGG + Intergenic
917004019 1:170391813-170391835 TTGGTTTAGCACCAACTCCTTGG + Intergenic
917100266 1:171438169-171438191 ATGGTTTAGCACCATCCTTTTGG - Intergenic
917101095 1:171446115-171446137 ATGGTTTAGCACCATCCTCTTGG + Intergenic
917365883 1:174231832-174231854 ATGGTTTAGCACCATCCCCTCGG - Intronic
917393696 1:174568244-174568266 ATGGCTTAGCACCATCCCTTTGG - Intronic
917406618 1:174713466-174713488 ATGGTTTAGCACCATCCCCTTGG + Intronic
918137039 1:181682828-181682850 ATGATTTAGCAGCATCCCCTCGG - Intronic
918207927 1:182325846-182325868 ATGGTGTAGCACCATCCCCTTGG + Intergenic
918227363 1:182496251-182496273 ATGGATTATCACCATCCCCTTGG - Intronic
918757568 1:188357190-188357212 ATGGTTTAGCACCATTCTCTTGG - Intergenic
918757811 1:188359218-188359240 ATGGTTTATCACCATCACTTTGG - Intergenic
918767121 1:188500434-188500456 ATGATTTAACACCATCCCCTTGG + Intergenic
918834954 1:189450126-189450148 ATGGGTTAGCACCATCCCCTTGG + Intergenic
919129524 1:193435816-193435838 ATGGTTTAGTACCATCCCCTTGG + Intergenic
919254761 1:195106487-195106509 ATGATTTAGCACCATCCACTTGG - Intergenic
919580226 1:199363121-199363143 ATGGTTTAGTTCCATCCCCTTGG + Intergenic
919816714 1:201445516-201445538 ATGGTTTAGCACCATCTCCTTGG + Intergenic
920480651 1:206318806-206318828 ATGGTTTAGCACCATCTCTGTGG - Intronic
920559342 1:206928065-206928087 ATGGTTCAGCACCAGAACCTAGG + Intergenic
920564766 1:206964496-206964518 ATGGTTTAGTACCATCCCCTTGG + Intronic
920607560 1:207404200-207404222 ATGGTTTAGCACCATCCACTTGG + Intergenic
920615711 1:207490954-207490976 ATGGTTTAGCACCATCCCCTTGG - Intergenic
920631449 1:207656756-207656778 ATGGTTTAGCACCGTCCCCTTGG - Intronic
920641934 1:207760881-207760903 ATGGTTTAGCACCGTCCCCTTGG - Intronic
920895514 1:210044928-210044950 ATGGTTTAGTACCATCCCCTTGG - Intronic
921013705 1:211168234-211168256 GTGGTTTAGCACCATCCACTTGG - Intergenic
921014033 1:211170578-211170600 ATGGTTTAGCACCATTCTCTTGG - Intergenic
921601183 1:217108563-217108585 ATGGTTTAGCACTATCCCCTTGG + Intronic
921732407 1:218593157-218593179 ATGGTTTAGCTTCATCCCCTTGG - Intergenic
921750073 1:218782096-218782118 ATGGTTTACCATCATCCCCTTGG + Intergenic
921933923 1:220778492-220778514 ATGGTTTAGCACCACCACCTTGG - Intronic
922433688 1:225582091-225582113 ATGGTTTAGCAACATCCCCTTGG + Intronic
922629522 1:227091353-227091375 ATGGTTTAGCATCATCCCCTTGG + Intronic
922660560 1:227426474-227426496 ATGATTTAGTACCATCCCCTTGG - Intergenic
922708773 1:227810167-227810189 ATGGTTTAGCAGCATTCCCTTGG + Intergenic
922760537 1:228127285-228127307 ATGGTTTAGCACCATCCTCTTGG - Intergenic
922999542 1:229995348-229995370 ATGGCTTAGCACCATCCTCTTGG + Intergenic
923067554 1:230532718-230532740 ATGGTTTAGCACCATCCTTTTGG + Intergenic
923293595 1:232571674-232571696 ATGGCTTAGCACCGTCCCCTTGG + Intergenic
923321814 1:232841886-232841908 ATGGTTTAACACCATCCCCTCGG - Intergenic
923415180 1:233749546-233749568 ATGGTTTAGCACCATCCATTTGG + Intergenic
923424445 1:233854840-233854862 ATGGTTTAGAACCATCCCTTTGG + Intergenic
923998168 1:239520375-239520397 ATCGTTTGGCACCATCTCCTTGG + Intronic
924049983 1:240070874-240070896 ATGGTTTATTCCCACCCCCTTGG - Intronic
924125782 1:240849603-240849625 ATGGCTTAGCACCCTCCCCTTGG + Intronic
924278077 1:242408451-242408473 ATGGTTTAGCACCATCCTGTTGG + Intronic
924313984 1:242776661-242776683 ATGGTTTAGTACCATCCTCTTGG - Intergenic
924452309 1:244189468-244189490 ATGGTTTGACACCATCCCCTTGG + Intergenic
924808397 1:247379772-247379794 ATGGTTTGACACCATCCCCTCGG + Intergenic
1062847113 10:716254-716276 ATGGATTAGCAGCACCACACAGG - Intergenic
1062951039 10:1503708-1503730 ATGGTTTAGCACCATCCTCTTGG + Intronic
1063034736 10:2275507-2275529 GTGGTTCAGCACCATCCCCTTGG + Intergenic
1063480006 10:6367229-6367251 ATGGTCTAGCACCATCCTCTTGG - Intergenic
1063624917 10:7679913-7679935 ATGGTTTAGTCCCATCCCCTTGG - Intergenic
1063678164 10:8160459-8160481 ATGGTTTAGCACCATCTCACTGG - Intergenic
1063840422 10:10065473-10065495 ATGATTTAGCACCATCCACTTGG - Intergenic
1063871656 10:10423514-10423536 ATGGGTTAGTACCATCCCCTTGG - Intergenic
1063905223 10:10774457-10774479 ATGGTTTAGCACCATCGCTTTGG + Intergenic
1064151483 10:12869339-12869361 ATGGTTTAGCATTATCCCCTTGG - Intergenic
1064562526 10:16607079-16607101 ATGGTTCAGCACTATCCCCTTGG + Intronic
1064628578 10:17286126-17286148 ATGGTCTAGCACCATCTTCTAGG - Intergenic
1064768676 10:18700929-18700951 ATGGTTTGGCACCATCCCTTTGG + Intergenic
1064768849 10:18702868-18702890 ATTCCTTAGCTCCACCACCTTGG + Intergenic
1065013959 10:21444343-21444365 ATGGGTTAGCTCCATCACCTGGG + Intergenic
1065207676 10:23372768-23372790 ATGGTTTAGCACCATCCACTTGG - Intergenic
1065242749 10:23724107-23724129 ATGGTTCAGCACCATCCCCTTGG - Intronic
1065376670 10:25050142-25050164 GTGGTTTGGCACCATCCCCTTGG - Intronic
1065376824 10:25051617-25051639 ATGGTTTAGCACCATCTGCTTGG - Intronic
1065430382 10:25648712-25648734 ATGGTTTGGCACCATCCCTTGGG + Intergenic
1065444119 10:25780135-25780157 ATGGTTTACCACCATCCCCTTGG - Intergenic
1065609988 10:27463416-27463438 ATGGCTTAGCATCATCCCCTTGG - Intergenic
1065692124 10:28345280-28345302 ATGGCTTAGCACCATCTCCTTGG + Intergenic
1065870562 10:29952787-29952809 ATGGTTTAGTACCATCCCCTTGG - Intergenic
1065872938 10:29971549-29971571 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1066001908 10:31112444-31112466 ATAGTTTAGCACCATCCTCTTGG - Intergenic
1066128123 10:32362367-32362389 ATGATTTAGCACCATCCTCTTGG + Intronic
1066151432 10:32623907-32623929 ACAGTTTAGCACCATCCCCTTGG - Intronic
1066247473 10:33597352-33597374 ATAGTTTAGCAACATCTCCTTGG + Intergenic
1066253064 10:33652887-33652909 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1066278867 10:33895599-33895621 ATGGTTTAGCGCCATCCTCTTGG + Intergenic
1066295741 10:34052718-34052740 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1066540700 10:36443836-36443858 ATGGTTTAGCGCCATGGCCTTGG + Intergenic
1066695737 10:38076191-38076213 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1066996800 10:42571373-42571395 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1067084825 10:43232219-43232241 ATGGGTTAGCACCATCCCCTCGG + Intronic
1067098989 10:43321190-43321212 ATGGGTCAGCACCATCCCCTCGG + Intergenic
1067128509 10:43540750-43540772 ATGGCTTAGCACCATTCCCTTGG + Intergenic
1067249158 10:44572619-44572641 ATGGTTTAGCATCATCCTCTTGG + Intergenic
1067539694 10:47142502-47142524 ATGGTTTAGCACTGTCCCCTTGG + Intergenic
1067580956 10:47445180-47445202 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1067895652 10:50176550-50176572 ATGGTTTAGCACCATTCTCTAGG - Intergenic
1067953335 10:50765428-50765450 ATGGTTTAGCACCATTCTCTAGG + Intronic
1068156616 10:53206818-53206840 ATGGCTTAGCGCCACGTCCTTGG + Intergenic
1068198203 10:53745855-53745877 ATGGTTTAGCACCATCCCTTTGG - Intergenic
1068200186 10:53774188-53774210 ATGGTTTATCACCATCTCCTTGG - Intergenic
1068210799 10:53917824-53917846 ATGGCTTAGCACCATCTCCTTGG + Intronic
1068722395 10:60260637-60260659 ATGGTTTAGCACCATCTGCTTGG + Intronic
1068934166 10:62619966-62619988 ATGGTTGAGAACCACTGCCTTGG - Intronic
1069217696 10:65842595-65842617 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1069296502 10:66851526-66851548 ATGGTTTAGCACCATCCGCGTGG + Intronic
1069336787 10:67360792-67360814 ATGGTTTAGTACCATTCCCTTGG - Intronic
1069361957 10:67653258-67653280 ATGGCTTAGCACCAGCCTCTTGG - Intronic
1069585678 10:69599921-69599943 AAGCTGTAGCCCCACCACCTTGG + Intergenic
1069740509 10:70684214-70684236 ATGGTTTAGCACTATCTTCTTGG - Intronic
1069742376 10:70693161-70693183 ATGGTTTAGCACGATCTCCTTGG - Intronic
1069975562 10:72209933-72209955 ATGGCTTAGCACCATCTCCTTGG + Intronic
1070108739 10:73461895-73461917 ATAGTTTAGCACCATCCCTTTGG + Intronic
1070385275 10:75918518-75918540 ATGATTTAGCACCATCCCCTTGG - Intronic
1070581886 10:77726976-77726998 ATAGTTTAGCACCATTTCCTTGG - Intergenic
1070703898 10:78623342-78623364 CTGGTTTAGTACCATCCCCTTGG - Intergenic
1071053969 10:81487269-81487291 ATGGTTTGGCACCATCCCCTTGG - Intergenic
1071249605 10:83803554-83803576 ATGGCTTAGCACCATCTCCTTGG - Intergenic
1071284881 10:84135362-84135384 ATGGATTAGCACTATCCCCTTGG + Intergenic
1071380292 10:85052735-85052757 ATGGTTTAACACCATCTCCTTGG - Intergenic
1071664527 10:87541836-87541858 ATGGTTTAGCATCATCCCCTTGG - Intronic
1071797380 10:89021151-89021173 ATGGTTTAGCACCAATCCCTTGG + Intergenic
1071860641 10:89669192-89669214 ATGGTTTAGCACCATCACCTTGG - Intergenic
1071884921 10:89939380-89939402 ATGTCTTAGCACCATCCCCTTGG + Intergenic
1071906232 10:90177081-90177103 ATGATTTAGTACCATCCCCTTGG + Intergenic
1071990016 10:91092571-91092593 ATGGTTTGGCACCATCCCTTTGG - Intergenic
1071995768 10:91147768-91147790 ATGGCTTAGCGCCATCCCCTTGG - Intergenic
1072014702 10:91335331-91335353 ATGGTTTAACATCGCCCCCTGGG + Intergenic
1072266057 10:93728952-93728974 ATGGGTTAGCAGCATCTCCTCGG + Intergenic
1072494288 10:95940220-95940242 ATGGTTTAACACCATCCCCTTGG - Intergenic
1072833235 10:98682121-98682143 ATGGTTTAGCACCATCTCCTTGG + Intronic
1072889755 10:99312923-99312945 ATGGCTCAGCACCATCTCCTTGG + Intergenic
1073538976 10:104302701-104302723 ATGGTTTAGCACCATTCTCTTGG + Intronic
1073547232 10:104361005-104361027 ATGGTTTAGCACCATCCTCTTGG - Intronic
1073579875 10:104655683-104655705 ATGGTTTAGCACCATCCTCTTGG + Intronic
1073676646 10:105654862-105654884 ATGATTTAGCACCATCCTCTTGG + Intergenic
1073701588 10:105933887-105933909 ATGGTTTAGCACCATCTCCTTGG + Intergenic
1073701922 10:105936220-105936242 ATGGTTTAGCGCTATCCCCTTGG + Intergenic
1073944887 10:108739238-108739260 ATGGTTTAGCACCATCCATTTGG - Intergenic
1074112617 10:110433287-110433309 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1074216940 10:111394372-111394394 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1074266197 10:111906006-111906028 ATGGTTTCGCACCATCCCTTTGG - Intergenic
1074290219 10:112132689-112132711 ATGGTTTAGTAACATCCCCTTGG + Intergenic
1074581872 10:114726808-114726830 ATGCTTTAGCGCCATCCCCTGGG - Intergenic
1074588830 10:114793247-114793269 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1074603087 10:114935154-114935176 ATGGTTTAGCACCAACCCCTTGG - Intergenic
1074702713 10:116106554-116106576 ATGGTTTAGCACCACCCTCTTGG + Intronic
1074708000 10:116152553-116152575 ATGGTTTAACACCATCGCATTGG - Intronic
1074737764 10:116453592-116453614 ATGGTTTAGTGCCACCCCCTTGG + Intronic
1075189326 10:120291987-120292009 ATGGTTTAGCACCATCCTCTCGG - Intergenic
1075309156 10:121397340-121397362 GTGGTTTAGCACCGTCTCCTTGG - Intergenic
1075421623 10:122305390-122305412 ATGGCTTAGCACCATCCTCTTGG + Intronic
1075470723 10:122687472-122687494 ATGGTTTGGCACCATACCCTCGG - Intergenic
1075628612 10:123985243-123985265 ATGGTTTAGTACCATCCCCTTGG - Intergenic
1075838490 10:125476801-125476823 ATGGTTTAGCCCCTTCCCCTTGG - Intergenic
1075898492 10:126019064-126019086 ATGGTTTAGCACCATCTCCTTGG + Intronic
1075902335 10:126053027-126053049 ATGGTTTAGCACCATCACCTTGG + Intronic
1076435259 10:130436718-130436740 ATAGTTTAGCACCATCCTCTTGG + Intergenic
1076465639 10:130679659-130679681 GTGGTTTAGCACCATCCTCTTGG + Intergenic
1076561278 10:131366405-131366427 ATGGCTTAGCACCATCCTCTTGG - Intergenic
1076767528 10:132644685-132644707 CTGTTGTAGCACCACCACCCCGG + Intronic
1077349794 11:2087273-2087295 ATGGCTTAGCACCATCCTCTTGG + Intergenic
1077381381 11:2240702-2240724 ATGGTTTAGCACCGTCCTCTTGG - Intergenic
1077680366 11:4234779-4234801 ATGGTTTAGTGCCACTACCAAGG - Intergenic
1077684646 11:4280196-4280218 ATGGTTTAGTGCCACTACCCAGG - Intergenic
1077690548 11:4337734-4337756 ATGGTTTAGTGCCACTACCAAGG + Intergenic
1077736711 11:4799439-4799461 ATGGCTTAGCACTATCTCCTTGG - Intronic
1077737023 11:4801898-4801920 ATGGCTTAGCACTATCTCCTTGG - Intronic
1077845289 11:6016094-6016116 ATGGTTTAACACCATCCCCCTGG + Intergenic
1078268604 11:9773883-9773905 ATGGTTTAGTACCATCAACTTGG - Intergenic
1078337439 11:10475279-10475301 ATGGTCTAGCACCATCTCCTTGG - Intronic
1078651640 11:13200268-13200290 ATGGTTTAGCACTATCCCTTTGG + Intergenic
1078809795 11:14747168-14747190 ATGGGTTAGCATCATCCCCTTGG - Intronic
1079150994 11:17898917-17898939 ATGATTTAGCACCACCCTCTCGG + Intronic
1079410683 11:20184578-20184600 ATGGCTTAGCACCATGACCTTGG + Intergenic
1079552895 11:21722678-21722700 ATGGCTTAGCACCATCCTCTTGG + Intergenic
1079585170 11:22116745-22116767 ATGATTTAGCACTATCCCCTTGG - Intergenic
1079834064 11:25308957-25308979 ATGGTTTACCACCATCCCTTTGG + Intergenic
1079883741 11:25959115-25959137 ATGGTTTAGTACCACCCTCCTGG + Intergenic
1079915510 11:26364704-26364726 ATGATTTAGCACCATCCCCTTGG - Intronic
1079915894 11:26367930-26367952 ATGGTTTAGCACTATCCCCTTGG - Intronic
1079975155 11:27082103-27082125 ATGGTTTAGCACCATCCACTTGG - Intronic
1079992575 11:27262004-27262026 ATGGTGTAGTACCATCTCCTTGG - Intergenic
1080173844 11:29338667-29338689 ATGGTTTAGCCCCATTCCCTTGG - Intergenic
1080199863 11:29656405-29656427 GTGGTTTAGCAGCATCCCCTTGG - Intergenic
1080474256 11:32575066-32575088 ATGGTTTAGGACCATCCCCTTGG - Intergenic
1080603927 11:33848221-33848243 ATGGTTTGGCACCACCACTTTGG + Intergenic
1081093153 11:38898059-38898081 ATCGTTTAGCACCATCCCCTTGG + Intergenic
1081208263 11:40300180-40300202 ATGGTTTAGCACCTCCCCTTTGG - Intronic
1081743349 11:45456254-45456276 ATGGTTTAACACCATCCCCTTGG + Intergenic
1081744041 11:45460569-45460591 ATGGTTTAGCACCATTCCTTTGG + Intergenic
1082644787 11:55709318-55709340 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1082779890 11:57278936-57278958 ATGGGTTAGCACCACTCCCTCGG - Intergenic
1084027225 11:66458753-66458775 ATGGTTTAGCACCATCCCTTTGG - Intronic
1084104557 11:66972770-66972792 ATGGTTTAGCCCCATCCCCTTGG + Intergenic
1084767348 11:71321303-71321325 ATGATTTAGCACCATCCTCTTGG + Intergenic
1084798315 11:71524217-71524239 ATGGTTTAGCACCATCTCCTTGG + Intergenic
1084806628 11:71583709-71583731 ATGGTTTAGCGCTATCCCCTTGG - Intronic
1085145586 11:74192656-74192678 ATGGTTTATTGCCATCACCTTGG + Intronic
1085180690 11:74533614-74533636 ATGGTTTAGCACCATCCCCTTGG - Intronic
1085241787 11:75062551-75062573 ATGGTTGAGCACCATCCCCTTGG + Intergenic
1085557506 11:77438303-77438325 ATGGTTTAGCACTATCCCCTTGG - Intronic
1085989211 11:81820680-81820702 ATGGTTTAGCACCGTCCCTTTGG - Intergenic
1086229019 11:84546202-84546224 ATGGTTTAGCATCATCTCCCTGG + Intronic
1086351471 11:85946103-85946125 ATGGTTTAACACCATCCCCTTGG - Intergenic
1086393676 11:86392025-86392047 ATGGTTTAACACCATCCCCCTGG - Intronic
1086456218 11:86961313-86961335 ATGTTTTAAAACCACCATCTGGG - Intergenic
1086505182 11:87497293-87497315 GTGGTTTAGCACCATCCCCTTGG + Intergenic
1086520782 11:87665695-87665717 ATGGCTTAGCACCATCCCCTCGG - Intergenic
1086732033 11:90262704-90262726 ATGGTTTAGCACTATCCACTTGG - Intergenic
1087037162 11:93767302-93767324 ATGGTTTAGCACTATCCCCCTGG + Intronic
1087059689 11:93965421-93965443 ATGGTTTAGCACGATCCCCTTGG - Intergenic
1087101093 11:94365428-94365450 ATGGTTTTGCAACATCCCCTTGG + Intergenic
1087171316 11:95052401-95052423 ACGGTTTTGCACCATCACCCTGG + Intergenic
1087449182 11:98296092-98296114 ATGGTTTAGCACCAAATCCTTGG + Intergenic
1087621404 11:100547069-100547091 ATGGGTTAGCACGATCCCCTGGG + Intergenic
1087768167 11:102179007-102179029 ATGGCTTCGCACCATCCCCTTGG - Intronic
1087891089 11:103538984-103539006 ATGGTTTATCATCATCCCCTTGG - Intergenic
1087898128 11:103610265-103610287 ATGGTGTAGCACTATCCCCTTGG + Intergenic
1088096062 11:106102657-106102679 ATGGTTTATCACCATCATCTTGG + Intergenic
1088352508 11:108905934-108905956 ATGGTTTAGTACCATCCCCTTGG - Intronic
1088369351 11:109072389-109072411 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1088566528 11:111178466-111178488 ATGATTTAGCACCATCCTCTTGG + Intergenic
1088678112 11:112215994-112216016 ATAGCTTAGCACCATCCCCTTGG - Intronic
1088910843 11:114191107-114191129 ATGGTTTAGCACCAACCTCTTGG - Intronic
1088939051 11:114435378-114435400 AGAGTTTAGCACCATCGCCTTGG - Intronic
1088989301 11:114937933-114937955 ATGGTTTTGCACCATCCCCTTGG + Intergenic
1089669385 11:120042986-120043008 ATAATTTAGCACCATCTCCTTGG - Intergenic
1089669668 11:120045031-120045053 ATGGTTTAACACCATCCCCATGG - Intergenic
1089896520 11:121935650-121935672 ATGGTGTAGCCCCAGCCCCTTGG - Intergenic
1090507129 11:127328142-127328164 ATGGTCTAGCACCATCACCTTGG + Intergenic
1090738384 11:129632908-129632930 ATGGCTAAGCATCACCACCAGGG + Intergenic
1091211726 11:133866312-133866334 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1091701866 12:2668723-2668745 ATGGTTTGGTACCATCCCCTTGG - Intronic
1091842697 12:3632070-3632092 ATGGTTTAGCACCTTCCCTTTGG + Intronic
1091978209 12:4843822-4843844 ATGGTTTGGCACCATGTCCTTGG - Intronic
1092014152 12:5143040-5143062 ATGGTTTGGCACCATCCCCTTGG - Intergenic
1092448824 12:8583226-8583248 ATGGTTTAACACTATCCCCTTGG + Intergenic
1092517258 12:9227515-9227537 ATGGGTTAGCACCATCCCCTTGG - Intergenic
1093114457 12:15192120-15192142 ATGGTTTAGCACCATCTCCTTGG + Intronic
1093186204 12:16022166-16022188 ATGTCTTAGCACCATCCCCTTGG + Intronic
1093223293 12:16449348-16449370 ATGATTTAGCACCATCCTCTTGG - Intronic
1093702764 12:22241320-22241342 ATGGCTTAGTACCATCCCCTTGG + Intronic
1093988781 12:25567594-25567616 ATGGTTTAGCAGCATCCCCTTGG + Intronic
1093989050 12:25569644-25569666 TTGGTTTAGCACCATCTCTTTGG + Intronic
1093990768 12:25587571-25587593 ATGGTTTAGCACCATCCGGTTGG - Intronic
1094084493 12:26574880-26574902 ATGGTCTAGCACCATCCCCTCGG - Intronic
1094128151 12:27045416-27045438 ATGGCTTAGCACCATCGTCTTGG - Intronic
1094254488 12:28407009-28407031 ATGATTTAGTACCATCCCCTTGG + Intronic
1094322903 12:29204857-29204879 ATGGGTTAGCACCATCTCCTTGG - Intronic
1094559366 12:31535958-31535980 ATGGTTTAGAGCCATCCCCTCGG + Intronic
1094762021 12:33544931-33544953 ATGGCTTAGCACCATCTCCTTGG - Intergenic
1095238715 12:39831679-39831701 ATGGTTTAGTGCCATCCCCTTGG + Intronic
1095344272 12:41130970-41130992 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1095367997 12:41431022-41431044 ATGGTTTACCACCATCCCCTTGG - Intronic
1095641834 12:44494757-44494779 ATGGTTTAACACCACCCCCTTGG - Intergenic
1095804669 12:46305410-46305432 ATTGTTTAGCATCACCCCCTTGG + Intergenic
1096518086 12:52169218-52169240 ATGGCTCAGCACCATCTCCTTGG - Exonic
1097337982 12:58406246-58406268 ATGGTATAGCGCCACAACCAGGG - Intergenic
1097375214 12:58835279-58835301 ATGGTTTAGCACCATCCCTTTGG - Intergenic
1097874816 12:64633365-64633387 ATGGCTTAGTACCACCTCCTTGG + Intronic
1098082762 12:66807305-66807327 ATGGTTTAGTACCATCCCCTTGG + Intergenic
1098246532 12:68524850-68524872 ATGGTTTAGTACTATCACCCAGG + Intergenic
1098306445 12:69107395-69107417 ATGGCTTAGTACCATCACCTTGG - Intergenic
1098391090 12:69970836-69970858 ATGGTTCAGCACCATCCCCTTGG + Intergenic
1098571138 12:71988580-71988602 ATGATTTAGCACCATCCTCTTGG - Intronic
1098601110 12:72332486-72332508 ATGGTTTAGCACCATCCCCTGGG - Intronic
1098644274 12:72879609-72879631 ATGGTTTAGTACCAACCCCTTGG - Intergenic
1098649378 12:72944988-72945010 ATGGTTTAGCATCAACCTCTTGG - Intergenic
1098717622 12:73851362-73851384 ATGGTTTAGCACCATTCCCTTGG + Intergenic
1098719291 12:73875220-73875242 ATGGTTTAGCACTATCCTCTTGG + Intergenic
1098903080 12:76132807-76132829 ATGGTTTAGTACCATTTCCTTGG - Intergenic
1098939710 12:76519836-76519858 ATGGTTTAGCGCCATCTCCTTGG - Intronic
1099016378 12:77348475-77348497 ATGATTCAGCACCATCCCCTTGG - Intergenic
1099138828 12:78943498-78943520 ATGGTTTAGCACCATGTCCTTGG - Intronic
1099658563 12:85526459-85526481 ATGGTTTATCACCATCTCCTTGG + Intergenic
1099858673 12:88203140-88203162 ATGGTTTAGCACCATCCACTTGG - Intergenic
1099890721 12:88585854-88585876 ATGGTTTAGCACCATGCCTTTGG - Intergenic
1099893941 12:88621592-88621614 ATGGTTTAGTACCATCCCCTTGG + Intergenic
1099941853 12:89198224-89198246 ATGGTTTAGCACCACCCTCTTGG + Intergenic
1099946921 12:89255392-89255414 ATGGCTTAGCACCGTCCCCTTGG - Intergenic
1099984525 12:89647802-89647824 ATGGTTCAGCATCATCCCCTTGG + Intronic
1099984791 12:89649829-89649851 ACAGTTTAGCACCATCCCCTTGG + Intronic
1100002559 12:89855134-89855156 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1100052071 12:90461010-90461032 ATGGTTTAGCACTACCTTCTGGG - Intergenic
1100052300 12:90462959-90462981 ATGGTTTAGCACTATCCCCTTGG - Intergenic
1100139473 12:91599470-91599492 ATAGTTTAGCACCATCCCCCAGG + Intergenic
1100142629 12:91636846-91636868 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1100194306 12:92226938-92226960 ATGGTTTAGCACCATCTCCCTGG + Intergenic
1100210932 12:92397949-92397971 ATGGTTTAGCACCATCTCTTGGG - Intergenic
1100216830 12:92459119-92459141 ATAGTTTAGCACCATCTCCCTGG - Intergenic
1100448341 12:94681604-94681626 ATGGTTTAGCACCATCTTCCTGG + Intergenic
1100501250 12:95175980-95176002 ATGGTTTAGCAGCAAAATCTAGG + Intronic
1100594049 12:96056271-96056293 ATGGTTTCGCATCATCGCCTTGG - Intergenic
1100630938 12:96388950-96388972 ATGGCTTAGCACCATCCCCTTGG - Intronic
1100807768 12:98305161-98305183 ATGGCTCAGCACCATCCCCTTGG + Intergenic
1100874066 12:98943936-98943958 ATGGCTTAGCGCCATCCCCTTGG + Intronic
1100899979 12:99227157-99227179 ATGGTTTACCATCATCCCCTTGG + Intronic
1100965391 12:100007438-100007460 ATGGTTTAGCACCATCCACTTGG - Intergenic
1101193417 12:102358346-102358368 ATGGTTTAGTAACATCCCCTTGG - Intergenic
1101309685 12:103564787-103564809 ACGGTTTAGCACCATCTGCTTGG + Intergenic
1101526045 12:105531964-105531986 ATGGTTTAGTACCATCCCATTGG - Intergenic
1101621736 12:106395481-106395503 CTGATTTAGCACCATCACCTTGG - Intronic
1101808368 12:108085263-108085285 ATGGCTTAGCACCATCTCCTTGG + Intergenic
1102448211 12:113019988-113020010 ATAGTTCAGCACCATCCCCTTGG + Intergenic
1103076654 12:117988621-117988643 ATGCTTTAGCACCATCCTCTTGG + Intergenic
1103233443 12:119351635-119351657 ATGGTTTAGCACTAACCTCTTGG - Intronic
1103532944 12:121615054-121615076 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1103705692 12:122870658-122870680 ATGGCTCAGCACGACCTCCTGGG - Intronic
1104183347 12:126404078-126404100 ATAGTTTACCACCATCCCCTTGG - Intergenic
1104225104 12:126823858-126823880 ATGGTTTAGTACCATCCCTTTGG + Intergenic
1104330900 12:127843891-127843913 ATGGTTTAGCACCATCCATTCGG - Intergenic
1104431410 12:128719423-128719445 ATGATTTAGCACCAACCTCTAGG - Intergenic
1104513740 12:129404757-129404779 ATGGCTTAACACCATCTCCTTGG - Intronic
1104827241 12:131721153-131721175 ATAGTTTCGCACCATCTCCTCGG - Intronic
1105557623 13:21461171-21461193 ATGGTTTAGTGCCATCCCCTTGG + Intergenic
1105659831 13:22481801-22481823 ATGGTTTAGCACCATCTTCTTGG + Intergenic
1105710638 13:23005488-23005510 ATGGTTTAGTGCCATCCCCTTGG - Intergenic
1105730643 13:23211968-23211990 ATGGCTTGGCACCATCCCCTTGG + Intronic
1105901457 13:24757951-24757973 ATGGTTTAGCACCGCCTCTTTGG + Intergenic
1106338700 13:28808100-28808122 ATGGTTTAGCACCATTCCTTTGG + Intergenic
1106463419 13:29992194-29992216 ATGGTTTAGTACCATCTCCTTGG + Intergenic
1106464194 13:29998200-29998222 ATGGTTTAGGACCATCCTCTTGG + Intergenic
1106619304 13:31358142-31358164 ATGGCTTAGCACCATCTCCTTGG + Intergenic
1106811460 13:33362318-33362340 ATAGTTTAGCACCATCTCTTTGG - Intergenic
1106831164 13:33584787-33584809 ATGGTTTACCACCATCCCCTTGG + Intergenic
1106865528 13:33960067-33960089 ATGGTTTAGCACCATTCCCTCGG - Intronic
1106947215 13:34842107-34842129 ATAGTTTAGCAACATCCCCTTGG + Intergenic
1107230872 13:38108796-38108818 ATGGTTTAGCATCATCCTCTTGG - Intergenic
1107231841 13:38119291-38119313 ATGGTTTAGCACCTTCCCTTTGG - Intergenic
1107354812 13:39555906-39555928 ATGGCTTAGTACCATCCCCTTGG + Intronic
1107417775 13:40217270-40217292 ATGGTTTAGCACCGTAGCCTCGG + Intergenic
1107517179 13:41141479-41141501 ATGGCTTAGCACCATCTCCTTGG - Intergenic
1107699422 13:43033089-43033111 GTGGTTTAGCGCCATCCCCTTGG - Intronic
1107950013 13:45453304-45453326 ATGGCTCAGCACCATCCCCTTGG - Intergenic
1107972154 13:45654124-45654146 ATGGTTTAGCACCATCTCCCTGG - Intergenic
1108005122 13:45938541-45938563 ATGGTTTAGCTCCATCCTCTTGG + Intergenic
1108056235 13:46488224-46488246 ATGGGTTAGCACTATCCCCTCGG - Intergenic
1108058551 13:46509583-46509605 CTGGTTTAGCGCCATCTCCTTGG + Intergenic
1108174409 13:47777534-47777556 ATAGTTTAGCTCCATCCCCTTGG + Intergenic
1108210845 13:48138459-48138481 ATGGTTTAACACCATCCACTTGG + Intergenic
1108237784 13:48427065-48427087 ATGGTTTAGCACCACCCCCTTGG - Intronic
1108263918 13:48685312-48685334 TTGGTTTAGCACCGTCCCCTCGG - Intronic
1108425132 13:50291820-50291842 ATGGTTTAGCTCCATTTCCTTGG - Intronic
1108680263 13:52774040-52774062 GTGGTTTAGCACCATCCTCTTGG - Intergenic
1108715930 13:53077812-53077834 ATGGTTAAGCACCATCCTCTTGG - Intergenic
1108735410 13:53278681-53278703 ATGGGTTAGCACCATTCCCTAGG - Intergenic
1108777598 13:53785171-53785193 ATGGTTTAGCACCTTCCCCTTGG - Intergenic
1108826799 13:54422368-54422390 ATGGTTTAACACCATCCCCTTGG + Intergenic
1108883837 13:55155529-55155551 ATGGTTTAGAACCATCCCTTTGG + Intergenic
1109139720 13:58699420-58699442 ATGGTTTAGCACCATTCCCTTGG - Intergenic
1109166511 13:59041544-59041566 ATGGTTTAGCATCATATCCTTGG - Intergenic
1109279983 13:60344846-60344868 ATGGCTTAACACCATCCCCTTGG + Intergenic
1109401088 13:61829499-61829521 GTGGTTTAGCACTATCTCCTTGG + Intergenic
1109620642 13:64900496-64900518 ATGGCTTAGCACTATCATCTTGG + Intergenic
1109799862 13:67362606-67362628 ATGGCTTAGCACCATCCCTTTGG - Intergenic
1109920754 13:69054875-69054897 ATGGTTTATTACCACCCCCTTGG - Intergenic
1110084088 13:71355372-71355394 ATGGGTTAGGGCCATCACCTTGG - Intergenic
1110161992 13:72389444-72389466 GTGGTTTAACACCATCCCCTTGG - Intergenic
1110187505 13:72692411-72692433 ATGGTTTAGTACCATCTCCTTGG + Intergenic
1110189634 13:72715646-72715668 ATGGTTTAGCACCATCCTCTTGG + Intronic
1110276996 13:73651959-73651981 GTGGTTTAGCGCCATCCCCTTGG - Intergenic
1110352034 13:74520183-74520205 ATGGTTTAGCACAGTCCCCTTGG - Intergenic
1110397566 13:75049409-75049431 ATGGCTTAGCACCATCTCTTTGG - Intergenic
1110411034 13:75204183-75204205 ATGATTTAACACCATCCCCTTGG - Intergenic
1110423135 13:75335614-75335636 ATGGTTTAGCACCATCCACTTGG + Intronic
1110502913 13:76249808-76249830 ATGGTTTAGTACCATCTCCTTGG + Intergenic
1110662383 13:78072400-78072422 ATGGCTTAGCACGATCCCCTCGG - Intergenic
1110760011 13:79221303-79221325 ATGGCTTAGCATCATCTCCTTGG + Intergenic
1110794357 13:79619737-79619759 ATGGTTTAGCACCATTCCCCTGG + Intergenic
1110929005 13:81192673-81192695 ATGGGTTAACACCATCTCCTTGG + Intergenic
1111051321 13:82885734-82885756 ATGATTTAGCAACACCATCTTGG - Intergenic
1111240192 13:85463870-85463892 ATGGTTTAGCACCATCCACATGG - Intergenic
1111320290 13:86618829-86618851 ATGGTTTAGCACCATTCCCTTGG + Intergenic
1111351906 13:87041985-87042007 ATGATTTAGCACTATCGCCTTGG - Intergenic
1111447882 13:88373831-88373853 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1111457914 13:88508097-88508119 ATGGCTTAGCACCATCCTCTTGG - Intergenic
1111458173 13:88510161-88510183 ATGGCTAAGCACCATCCCCTTGG - Intergenic
1111494697 13:89033174-89033196 ATGGTTTAGCACCATCTTCTTGG + Intergenic
1111494935 13:89035228-89035250 GTGGTTTAGCACCATCCACTTGG + Intergenic
1111528540 13:89506420-89506442 ATGGTTTACCACTATCCCCTTGG + Intergenic
1111578628 13:90192758-90192780 ATGGTTTAGCACCGTCCCTTTGG + Intergenic
1111668875 13:91303330-91303352 ATGGTTTAGCACTATCCCCTCGG - Intergenic
1111877856 13:93919027-93919049 ATGGCGTAGCACCATCCCCTTGG + Intronic
1112025004 13:95403863-95403885 ATGGTTTGGCGCCATCCCCTTGG - Intergenic
1112040471 13:95542175-95542197 ATGGTTCAGCACCATCCCCTTGG - Intronic
1112252495 13:97795115-97795137 ATGGTTTAGCACCATCCCATTGG - Intergenic
1112295232 13:98180336-98180358 GTGGTTTAGCACCATTTCCTGGG - Intronic
1112314866 13:98351836-98351858 GTGGTTTGGCACCAGCTCCTTGG - Intronic
1112315022 13:98353101-98353123 ATGGCTTCGCACCATCCCCTTGG - Intronic
1112450889 13:99508801-99508823 ATGGGTTGGCACCACTCCCTTGG - Intronic
1112885265 13:104162656-104162678 ATGGTTTAGCACTGCATCCTTGG + Intergenic
1113013167 13:105793890-105793912 ATGGTTTAGCACCATCACCTTGG - Intergenic
1113257604 13:108523932-108523954 ATGGTTTAGCACCATCCTTTTGG + Intergenic
1113419294 13:110157739-110157761 AAGGTTTAGCACCTCCCCGTTGG + Intronic
1113507767 13:110828936-110828958 ATGGCTTAGTACCATCCCCTTGG - Intergenic
1113711954 13:112471278-112471300 GTGGATTAGCACCATCCCCTTGG - Intergenic
1113980445 13:114270345-114270367 ATGGTTTAGTACCATCCTCTTGG - Intronic
1114013771 14:18404781-18404803 ATGATTTTGCACCATCCCCTTGG - Intergenic
1114244616 14:20901099-20901121 ATGGTTTAGCACCAAATCCTTGG - Intergenic
1114247609 14:20929242-20929264 ATGGTTTAGCACCAAATCCTTGG - Intergenic
1114248712 14:20938371-20938393 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1114347291 14:21809288-21809310 ATGGTTTAACACCATTCCCTTGG + Intergenic
1114400403 14:22405056-22405078 ATGGTTTAGCTCCATCCCCTTGG + Intergenic
1114540231 14:23449999-23450021 ATGGTTTAGCTCCATCCCCTTGG + Intergenic
1114881200 14:26788393-26788415 ATGGTTTAGTACCATCCCCTTGG + Intergenic
1114917232 14:27284268-27284290 TTGGCTTAGCACCATCTCCTTGG + Intergenic
1114927402 14:27421458-27421480 ATGGCTTAGCACCATCTCCTTGG - Intergenic
1115073916 14:29362725-29362747 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1115121238 14:29940632-29940654 ATGGTTCAGCATCATCCCCTTGG + Intronic
1115874634 14:37846539-37846561 AGGGTTTAGCACCACCTTTTTGG + Intronic
1115936732 14:38560836-38560858 ATGGTTTAGCACCACCCCTGTGG - Intergenic
1116252039 14:42498798-42498820 ATGGTTTAGTATCACCCGCTTGG + Intergenic
1116280750 14:42903707-42903729 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1116352835 14:43887374-43887396 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1116651845 14:47603815-47603837 ATGGCTTAGCACCATCCCCTTGG + Intronic
1116681523 14:47976410-47976432 ATGGCTTATCACCATCCCCTTGG - Intergenic
1117000976 14:51370891-51370913 ATGGTTTAGTGCCATCCCCTTGG - Intergenic
1117063250 14:51983799-51983821 ATGCTTTAGCACTATCTCCTTGG + Intergenic
1117092037 14:52261190-52261212 ATGGTTTGGCACCATCTGCTTGG + Intergenic
1117154295 14:52922561-52922583 ATGTTTTAGCACCTACTCCTGGG - Intronic
1117240044 14:53822111-53822133 ATGGTTTAGCACTATCTCCTTGG - Intergenic
1117497509 14:56320043-56320065 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1117778642 14:59208785-59208807 ATGGCTCAGCACCATCCCCTTGG + Intronic
1117819789 14:59636262-59636284 ATGGTTTAGCACCATCCCCTTGG + Intronic
1117886870 14:60372782-60372804 ATGGTTTATCACCATCCTCTCGG + Intergenic
1117941682 14:60973477-60973499 ATGGTTTAGCACTATCCCCTTGG - Exonic
1118000177 14:61515621-61515643 ATGGTCTGGCACCAGTACCTTGG - Intronic
1118024619 14:61756408-61756430 ATGGTTTAGCACCATCCTTTTGG - Intergenic
1118145316 14:63128429-63128451 ATGGTTTGGCACCATCCCTTTGG + Intergenic
1118538391 14:66794207-66794229 ATGGTTTAGTACCATCCCCTTGG + Intronic
1118660643 14:68006042-68006064 ATGGTTTAGCACCATCACTTTGG - Intronic
1118898799 14:69969537-69969559 AATGTTTAGCACCATCTCCTTGG - Intronic
1118993452 14:70816718-70816740 ATGGTTTAGCACTATCCCCTTGG - Intergenic
1119050112 14:71358892-71358914 ATGATTTAGCACCATCCCTTTGG - Intronic
1119052480 14:71383769-71383791 ATGGATTAGCACCATCCCCTTGG - Intronic
1119102168 14:71889810-71889832 ATGGTTTAACGCCATCCCCTTGG + Intergenic
1119103361 14:71900995-71901017 ATGGCTTAGCACTATCCCCTTGG - Intergenic
1119113803 14:71999629-71999651 ATGGTTTAGCACCGTCCCCTTGG + Intronic
1119144125 14:72294779-72294801 ACGGTTTAGCACCACCCCTTTGG - Intronic
1119586547 14:75841089-75841111 ATGGCTTAGCACCATCCCCTTGG - Intronic
1119611916 14:76070693-76070715 ATGGTTTGGCACCATCCCCTTGG + Intronic
1120004892 14:79345633-79345655 ATGGTTTAGCACCCTCCCTTTGG + Intronic
1120072679 14:80121507-80121529 ATGGTTTATCATCATCCCCTTGG + Intergenic
1120197778 14:81504758-81504780 ATGGCTTAGCACCATCCCCTTGG + Intronic
1120680745 14:87477794-87477816 ATGGTTTAGTACCATCCCTTTGG - Intergenic
1120707916 14:87763405-87763427 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1120819396 14:88898030-88898052 ATGGTTTAGCTCCATCCCCTGGG - Intergenic
1120855672 14:89210209-89210231 ATGGTTCAGCACCATCCCTTTGG + Intronic
1120858598 14:89234531-89234553 ATGGTTGAACACCATCCCCTTGG + Intronic
1120902513 14:89588077-89588099 AAGGTTTAGCACCATCCTCTTGG + Intronic
1120909880 14:89656602-89656624 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1121140602 14:91538558-91538580 ATGGTTTAGCGCCATCCTCTTGG - Intergenic
1121162697 14:91759799-91759821 ATAGTTTAGCACCATCCCTTTGG + Intronic
1121166847 14:91810218-91810240 ATGGCTTAGCACCATCTCCTTGG - Intronic
1121267188 14:92612043-92612065 ATGGGTTAGCACCATCCCCTCGG - Intronic
1121372811 14:93375759-93375781 ATGGTTTAGTGCCATCCCCTTGG - Intronic
1121383394 14:93494249-93494271 ATGGTTTAGCACCATCCCTTTGG - Intronic
1121624985 14:95377320-95377342 ATGGTATAGCACCATTCCCTCGG - Intergenic
1121681054 14:95792940-95792962 ATGGCTTAGTACCATCCCCTTGG + Intergenic
1122180175 14:99949219-99949241 ATGTTTTAGTACCATCCCCTTGG - Intergenic
1122361917 14:101172639-101172661 ATGGTTTAGCACTGTCCCCTTGG - Intergenic
1122495690 14:102153053-102153075 ATGGTTTAGCACCATCTACTTGG + Intronic
1202837480 14_GL000009v2_random:89189-89211 GTGGTTCAGCACCATCCCCTTGG + Intergenic
1202891493 14_KI270722v1_random:163358-163380 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1123875402 15:24618787-24618809 ATGGTTTAGCATCATTCCCTTGG - Intergenic
1124733299 15:32218978-32219000 ATGGTTTAGCACTCTCCCCTTGG - Intergenic
1125002422 15:34785356-34785378 ATGGTTTGGCACCATCCCCTTGG + Intergenic
1125628353 15:41127504-41127526 ATGGCATAGCACCATCCCCTCGG + Intergenic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1125798618 15:42424421-42424443 ATCATTTAGAAGCACCACCTTGG - Intronic
1126336781 15:47593892-47593914 ATGGTTTAGCACCATCCCCTTGG - Intronic
1126563003 15:50064932-50064954 GTGGGTTAGCACCATCCCCTCGG - Intronic
1126658582 15:51008391-51008413 ATGGCTTAGCACCATCCCCTTGG - Intergenic
1126732354 15:51696796-51696818 ATGGTTTAGCACCATCTCCTTGG - Intronic
1126855748 15:52837853-52837875 ATGGCTTAACACCATCCCCTTGG + Intergenic
1126907476 15:53383609-53383631 ATGCTTTAGCACCATCCTCTTGG - Intergenic
1126955973 15:53934174-53934196 ATGGTTTAGCACCATCCACTTGG - Intergenic
1127232411 15:57011255-57011277 ATGGTTTAGAACCATCTGCTTGG + Intronic
1127440277 15:58999963-58999985 ATGGTTCAGCACCATCCCTTTGG - Intronic
1127550551 15:60033526-60033548 ATGGTTTAGCACCATCTCTTTGG + Intronic
1127577470 15:60305823-60305845 ATGGTTTAGCACCATCACCCTGG - Intergenic
1127855195 15:62948332-62948354 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1128495831 15:68198020-68198042 ATGGATCAGCACCCCCACCTGGG + Intronic
1128680006 15:69643610-69643632 ATGGTTTAGCACCATCCCTTTGG - Intergenic
1128839892 15:70841592-70841614 ATGGTATAGCACCACTCCCTTGG + Intronic
1128902483 15:71437222-71437244 ATGGCTTAGCACCATATCCTTGG - Intronic
1129104677 15:73298193-73298215 ATGGATTAGCACCACTGCCAGGG - Intronic
1129314661 15:74734197-74734219 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1129636569 15:77324790-77324812 ATGGTTTAGTACCATCCCCTTGG - Intronic
1129927263 15:79375700-79375722 ATGATTTAGCACCATCCTCTTGG - Intronic
1130050069 15:80476953-80476975 ATGGTTTAGTACCATCCTCTTGG + Intronic
1130603444 15:85294014-85294036 ATGGTTTAGCACCATTCCTTTGG - Intergenic
1131285366 15:91052492-91052514 ATGGTTTAGCACCACCCTTTTGG + Intergenic
1131291661 15:91111942-91111964 ATGGTTTGGCACCATTCCCTTGG - Intronic
1131350544 15:91695639-91695661 ATGGTTTAGCACCGACTCGTTGG + Intergenic
1131377696 15:91939303-91939325 ATGGTTCAGCACCATCCTCTTGG - Intronic
1131396895 15:92093400-92093422 ATGGCTCAGCACCGCCCCCTTGG - Intronic
1131520860 15:93113841-93113863 ATGGTTTAGCACCATCCTCTCGG + Intergenic
1131612095 15:93976036-93976058 ATGATTTAGCACCATCCTCTTGG + Intergenic
1131964066 15:97819846-97819868 ATGGGTTAGCACCATCTCCTTGG - Intergenic
1133296428 16:4754887-4754909 ATGGTTTGGCACCATCCTCTTGG + Intronic
1133453405 16:5922226-5922248 ATGGATTAACACCATCCCCTTGG - Intergenic
1133507085 16:6422739-6422761 ATGATTTGGCACCATCCCCTTGG - Intronic
1133714682 16:8435783-8435805 ATGGTTTAGCATCATCCTCTTGG - Intergenic
1133821157 16:9237650-9237672 ATGGTTTGGCACTATCCCCTTGG + Intergenic
1133865320 16:9636798-9636820 ATGGTTTAACACCATCTCCTCGG - Intergenic
1134332443 16:13263378-13263400 ATGGTTTAGCACCATTCCCTTGG + Intergenic
1134627104 16:15730003-15730025 ATGGTTTAGCACTATCCCTTTGG + Intronic
1134765645 16:16755525-16755547 ATGGTTTAGCACTATCCCTTTGG - Intergenic
1134768263 16:16781419-16781441 ATGGTTTAGCACCATCGCGTTGG + Intergenic
1134980404 16:18603688-18603710 ATGGTTTAGCACTATCCCTTTGG + Intergenic
1135151724 16:20012853-20012875 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1135203790 16:20464583-20464605 ATGGCTTAGCACCATCCCCTTGG - Intronic
1135215213 16:20560356-20560378 ATGGCTTAGCACCATCCCCTTGG + Intronic
1135751545 16:25062410-25062432 ATGGTTTAGGACCATCCTCTTGG + Intergenic
1135821214 16:25688218-25688240 ATAGTTTACCACTACCCCCTTGG + Intergenic
1135900247 16:26451774-26451796 ATGGTTTAGCACCGTCCCCTTGG - Intergenic
1135930548 16:26732647-26732669 ATGGTTTAGCACCATCTTCTTGG + Intergenic
1136358211 16:29760470-29760492 ATGTTTTAAAACCACCACGTAGG - Intergenic
1136421239 16:30134812-30134834 ATGGTTTAGCGCCATCCCTTTGG - Intergenic
1136926239 16:34377400-34377422 ATGGCTTAGCGCCATCCCCTTGG + Intergenic
1136978335 16:35034407-35034429 ATGGCTTAGCGCCATCCCCTTGG - Intergenic
1137421832 16:48341510-48341532 ATGGTTTAGCCCCATCCCCTTGG - Intronic
1137472663 16:48775831-48775853 ATGATTTAGCAACATCTCCTTGG + Intergenic
1137652212 16:50130264-50130286 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1137746965 16:50829352-50829374 GTGGTTTAGCACTATCCCCTTGG + Intergenic
1137967971 16:52955626-52955648 GTGGTTTAGCCCCATCCCCTTGG + Intergenic
1138540824 16:57686381-57686403 ATGGCTTAGCACTATCCCCTTGG - Intronic
1138732351 16:59209025-59209047 ATGGCTTAGCACTATCCCCTTGG + Intergenic
1138795876 16:59968379-59968401 ATGGTTTAGCGCCATCCCCTTGG - Intergenic
1138923177 16:61557340-61557362 ATGGTTTAGCACCGTCCTCTTGG + Intergenic
1138987679 16:62350100-62350122 ATGGTTTAGCACCATCCACTTGG - Intergenic
1139106246 16:63830426-63830448 ATGGTTTAGCACCATCTCCTTGG + Intergenic
1139128087 16:64106287-64106309 ATAGTTTAGTACCATCCCCTTGG + Intergenic
1139183708 16:64777508-64777530 ATGATTTAGCACCATCACTTTGG + Intergenic
1139314554 16:66057187-66057209 AAGGTTTAGAGCCACCAGCTGGG + Intergenic
1139342235 16:66275123-66275145 ATGGTGCAGCACCACCCTCTTGG + Intergenic
1139360230 16:66393538-66393560 ATGGGTTAGCTCCATCCCCTAGG - Intronic
1140256259 16:73338838-73338860 ATGGTTTAGCACCATCCGCTTGG + Intergenic
1140331489 16:74061517-74061539 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1140539363 16:75741742-75741764 ATGGTTTAGCACCAACTGCTTGG + Intronic
1140634251 16:76892595-76892617 ATAGTTTAGCACCATCCCCTCGG + Intergenic
1140660698 16:77189541-77189563 ATGGTTTAGCATCATCCTCTTGG + Intergenic
1140704521 16:77614176-77614198 ATGGTTTAGCACCACCCGCTTGG + Intergenic
1140712383 16:77690612-77690634 ATGGTGTAGCACCATCTGCTCGG - Intergenic
1140716097 16:77727052-77727074 ATGGTTTAGCACCATCATCTTGG - Intronic
1140864068 16:79044396-79044418 ATGGTTTACCACCATCCTCTTGG + Intronic
1141121549 16:81362327-81362349 ATGGTTTGGCTCCATCACCAAGG + Intronic
1141337571 16:83171317-83171339 ATGGTTTAGGACCATCCCTTTGG - Intronic
1141364662 16:83431758-83431780 ATGGTTTAGTGCCATCCCCTTGG - Intronic
1142785751 17:2221263-2221285 ATGGTTTAGCACCATCCTCCTGG + Intronic
1143326774 17:6104219-6104241 ATGGCTTAGCACCATCCGCTTGG - Intronic
1143413070 17:6724003-6724025 ATGGCTCAGCACCATCTCCTTGG - Intergenic
1143427318 17:6850274-6850296 ATGGTTTATCACCATCTCCTTGG + Intergenic
1143936006 17:10484848-10484870 ATGGTTAAGCACTATCCCCTTGG - Intergenic
1143986385 17:10918213-10918235 AAGTTTTACCCCCACCACCTTGG + Intergenic
1144087941 17:11827519-11827541 ATGGCTTAGTACCATCCCCTCGG - Intronic
1144148136 17:12417972-12417994 ATGGCCTAGCACCATCTCCTGGG - Intergenic
1144274793 17:13655982-13656004 ATGGTTTAGCACCATCCTCATGG + Intergenic
1144446063 17:15330411-15330433 ATGGTTTAGCACCGTCCCTTCGG + Intronic
1146547094 17:33749098-33749120 AAGGTGAAGCAGCACCACCTAGG + Intronic
1148626584 17:49074001-49074023 ATGGTTTAGCGCCATCCCATTGG + Intergenic
1149456218 17:56790784-56790806 ATGGTGTAGTACCATCCCCTTGG + Intergenic
1149718660 17:58820121-58820143 ATGGTTTAGCACCATCCCCCTGG - Intronic
1150526877 17:65932767-65932789 ATGATTTAGCATCATCCCCTTGG - Intronic
1150573325 17:66407290-66407312 ATGGTTTAGCACCATCACCTTGG + Intronic
1150574075 17:66414249-66414271 ATGGTTTAGCCCCATCACCTTGG + Intronic
1150835321 17:68558447-68558469 ATGGCTTAGCACCGTCTCCTTGG + Intronic
1150956788 17:69868471-69868493 ATGGATTATCACCACCCCCTTGG - Intergenic
1151018119 17:70580558-70580580 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1151045523 17:70916074-70916096 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1151045805 17:70918144-70918166 ATAGTTTAGCACCATCCCTTGGG + Intergenic
1151148848 17:72066346-72066368 ATGGTTTAGTACCATCCCTTTGG - Intergenic
1151415474 17:73959601-73959623 ATGGCTTAGCACTACCTCCTTGG + Intergenic
1151847881 17:76670851-76670873 ATGGTTTATCACATTCACCTCGG - Intergenic
1151901848 17:77021145-77021167 ATGGTTTAGCACCATCCTATTGG + Intergenic
1152153005 17:78614666-78614688 ATGGGTTAGCACCATCCCCCTGG + Intergenic
1152300572 17:79493235-79493257 ATGGCTTAGTACCACCCCCTTGG - Intronic
1152919812 17:83060575-83060597 AGGGTTCAGCACCATCCCCTTGG + Intergenic
1153029903 18:703849-703871 ATGGTTTAGCACTATCCCATTGG + Intronic
1153232730 18:2955461-2955483 ATGGCTTAGCACCATCCACTTGG - Intronic
1153461473 18:5338583-5338605 ATGGTATAGCACCATCCTCTTGG + Intergenic
1153615724 18:6931195-6931217 ATGGTTTCTCACCCCCCCCTTGG + Intergenic
1153744048 18:8158880-8158902 ATGGTTTAACACCATCCCTTTGG - Intronic
1153832910 18:8938917-8938939 ATGGGCTAGCACCATCCCCTCGG + Intergenic
1153966248 18:10184832-10184854 ATGGTTTGGCACCATCCCGTTGG + Intergenic
1154508592 18:15068964-15068986 ATGTTTTATCACCATCCCCTTGG - Intergenic
1155271615 18:24147225-24147247 ATGGTTTTGCACTGTCACCTAGG - Intronic
1155350412 18:24900568-24900590 ATGGTTTAGCTCCATCCCTTTGG - Intergenic
1155430593 18:25752038-25752060 ATGGTTTAGCACAATCCTCTTGG + Intergenic
1155465287 18:26127963-26127985 ATAGTTTAGCACCATCCCCTAGG + Intergenic
1155621949 18:27789358-27789380 ATGGCTTGGCACCATCCCCTTGG - Intergenic
1155901226 18:31393566-31393588 ATGGTTTACCACCATAGCCTTGG - Intronic
1156524851 18:37757419-37757441 ATAGTTTAGCACCATCCCCTTGG + Intergenic
1156789308 18:40952533-40952555 ATGGTTTAGCACCATTCTCTTGG + Intergenic
1156819378 18:41354268-41354290 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1156960375 18:43021566-43021588 ATGGTTTAGCACCATTCCCTGGG + Intronic
1157225749 18:45862525-45862547 ATGGTTTAGCACCATCCTCTTGG + Intronic
1157396673 18:47347324-47347346 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1157407894 18:47438734-47438756 ATGATTTAGCACCATCCTCTTGG + Intergenic
1157516274 18:48313880-48313902 ATGGCTTAGCACCATCTCCTTGG + Intronic
1157543845 18:48533961-48533983 ATGGTTTAGCACCATTCCGTTGG - Intergenic
1157715918 18:49887054-49887076 ATGCTGTAGCACCATCCCCTTGG + Intronic
1157891999 18:51426687-51426709 ATGGATTAGCACCATCCCCTTGG + Intergenic
1157929058 18:51800419-51800441 ATGGTTTAGCACCATCCGTTTGG - Intergenic
1158125240 18:54093666-54093688 ATGGGTTAGCACCATCCCCTTGG - Intergenic
1158316254 18:56214075-56214097 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1158406121 18:57161224-57161246 ATGGTTTAGCACCATCCCTTTGG - Intergenic
1158504908 18:58038895-58038917 ACGGCTTAGCACCATCACCTTGG + Intergenic
1158784757 18:60696846-60696868 ATGGTTTTGCACCATCCCCGGGG + Intergenic
1158904925 18:62002526-62002548 GTGGCTTAGCACCATCCCCTTGG - Intergenic
1159030841 18:63229494-63229516 ATGGTTTAGCACTATCCCCTTGG + Intronic
1159089208 18:63828177-63828199 ATGGTTTAGCACTATCTCCTTGG + Intergenic
1159218640 18:65429570-65429592 ATGGTTTAGCACCATGTCCTCGG + Intergenic
1159449308 18:68579419-68579441 ATGGTTTAGCATCATCTTCTTGG + Intergenic
1159465929 18:68784380-68784402 ATGGTTTACAACCATCCCCTTGG - Intronic
1159564492 18:70033065-70033087 ATGGTTTAGCACCGTCCCTTTGG + Intronic
1159702726 18:71649912-71649934 ATGATTTAGTACCATCCCCTTGG + Intergenic
1159759667 18:72408766-72408788 ATGGTTTAGTACCATCCCCTTGG + Intergenic
1160611032 18:80085245-80085267 ACGGGTTAGCACCATCCCCTCGG + Intronic
1161746150 19:6061376-6061398 ATGGTCTGGAACCCCCACCTTGG - Intronic
1162311424 19:9909685-9909707 AAGGTTTAGCACCCCAACGTCGG - Intronic
1164424535 19:28129128-28129150 ATGGTTTAGCACCATTCCCTTGG + Intergenic
1164475979 19:28576329-28576351 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1164538215 19:29102666-29102688 ATAGTTTAGCACCATCCTCTTGG + Intergenic
1164724407 19:30456461-30456483 GTGGTTTAGCTCTGCCACCTCGG - Intronic
1164766403 19:30775454-30775476 ATGGTTTAGTACCAATCCCTTGG + Intergenic
1165192100 19:34073370-34073392 ATGGTTTAGTGCCAGCCCCTTGG + Intergenic
1165557533 19:36647820-36647842 ATGGTTTAGCACCATTCCCTTGG + Intronic
1165884358 19:39067094-39067116 ATGGGTGAGCACCATCCCCTTGG - Intergenic
1166025294 19:40077490-40077512 ATGGCTTAGCACCATCCCCTTGG - Intronic
1166560280 19:43728236-43728258 ATGGTTCAGCGCCAGCCCCTTGG + Exonic
1167225596 19:48237358-48237380 ATGGTTTAGCACCATTCCTTTGG - Intronic
1167346414 19:48948243-48948265 ATGGTTTAGCACCATCACCTTGG + Intergenic
1167725011 19:51205469-51205491 ATAGTTCAGCACCATCTCCTTGG + Intergenic
1167769273 19:51503932-51503954 ATGGCTTAGCACCATCTTCTTGG + Intergenic
1168264473 19:55214702-55214724 ATGGTTTAGTACCATCCCCATGG - Intergenic
1168357405 19:55710546-55710568 ATGGTTGAGCACCATCCCTTTGG + Intronic
1168448414 19:56444414-56444436 ATGGCTTAGCACCATTCCCTTGG - Intronic
1202635162 1_KI270706v1_random:38162-38184 GTGGTTCAGCACCATCCCCTTGG - Intergenic
1202650056 1_KI270706v1_random:171943-171965 GTGGTTCAGCACCATCCCCTTGG + Intergenic
925009774 2:474470-474492 ATGGTTTAGCACCATCCCCTTGG - Intergenic
925061629 2:895895-895917 ATGGTTTGGCACCATTCCCTTGG + Intergenic
925071551 2:972657-972679 ATGGTTTGGCACCATCCCCTTGG + Intronic
925122637 2:1431176-1431198 ATGGTTTAGCCCCATCCTCTTGG + Intronic
925392958 2:3511086-3511108 ATGGTTCAGCGCCACTCCCTTGG + Intronic
925559991 2:5181191-5181213 ATGGCTTACCACCATCCCCTTGG - Intergenic
925578133 2:5381492-5381514 ACGGTTTAGCACTATCTCCTCGG + Intergenic
925606047 2:5661366-5661388 ATGGTTCAGCACCATCCCATTGG - Intergenic
925663332 2:6225398-6225420 ATGGTTTAGAACCATCTGCTTGG + Intergenic
925822553 2:7814661-7814683 GTGGTTTAGCACCATCTTCTTGG + Intergenic
925882167 2:8362059-8362081 ATGGCTTCGCACCATCCCCTTGG + Intergenic
926133647 2:10321271-10321293 ATGGTTTCTCACCATCCCCTTGG - Intronic
926227107 2:10974798-10974820 ATGGTTTAGCACCATCCTCTCGG - Intergenic
926283995 2:11472932-11472954 ATGGTTTAGCGCCGTCCCCTTGG - Intergenic
926608916 2:14925688-14925710 ATGGTTTATCACTGCCTCCTCGG + Intergenic
926629479 2:15123561-15123583 ATGGCTTAGCACCATCTCCTTGG + Intergenic
926660313 2:15458431-15458453 GTGGTTCAGCACCATCCCCTTGG + Intronic
926831203 2:16964211-16964233 ATGGTTTAGGATCATCCCCTTGG + Intergenic
926925221 2:17980519-17980541 ATGGTTTAGAACCATCCCCTTGG + Intronic
926950941 2:18242768-18242790 ATGGTTTAACACCATCCTCTTGG + Intronic
927131941 2:20067752-20067774 ACGGTTTAGCACCATCTCCTTGG + Intergenic
927141258 2:20132436-20132458 ATGGTTTAGCACCATCCTCTTGG - Intergenic
927716517 2:25356580-25356602 ATGGTTTAACGCCATCCCCTTGG + Intergenic
927838045 2:26417063-26417085 ATAGTTTAGCACCATCCTCTTGG - Intronic
928231208 2:29500237-29500259 AAGGTTTCGCACCATCCCCTCGG + Intronic
928235544 2:29536275-29536297 ATGGTTTAGCTCCATCCCCTTGG + Intronic
928235810 2:29538323-29538345 ATGGTTTAATACAACCCCCTTGG + Intronic
928483030 2:31702881-31702903 ATGGTTTAGCTCTATCCCCTTGG + Intergenic
928529983 2:32181114-32181136 ATAGTTTAGTAACACCACTTTGG - Intronic
928619855 2:33077589-33077611 ATGATTTATCACCATCCCCTTGG - Intronic
928871698 2:35988385-35988407 ATGGTTTAGCACCATCTCCTTGG - Intergenic
929091605 2:38222980-38223002 ATGGTTTAGCACCATCTCCTTGG - Intergenic
929095959 2:38263514-38263536 ATGGTTTGTCACCATCCCCTTGG - Intergenic
929547947 2:42868261-42868283 ATGGTTTAGCACCATCCTCTTGG - Intergenic
929695229 2:44108949-44108971 ATGGTTTAGCACCATCCTTTTGG + Intergenic
929785555 2:44988354-44988376 ATGCTTTAGCACCATCTCCTTGG - Intergenic
929806577 2:45151472-45151494 ATGGTTTAGCACCATCCTCTTGG + Intergenic
930119233 2:47746545-47746567 ATGGGTTAGCACCATCCCGTTGG + Intronic
930600060 2:53432502-53432524 ATGGTTTACTACCATCCCCTTGG + Intergenic
930906494 2:56574663-56574685 ATGACTTAGCGCCACCCCCTTGG + Intergenic
930952035 2:57155266-57155288 ATGGTTTAGCACCATCACCTTGG - Intergenic
930952289 2:57157344-57157366 ATGGTTTATCACCATTACTTTGG - Intergenic
931135765 2:59398919-59398941 ATGGTTTAGCGCCATCCTCTTGG - Intergenic
931528006 2:63179397-63179419 ATGGTTTAGCACCATCCCCTTGG + Intronic
931814364 2:65886138-65886160 ATGGTTTAGCACTGCCCCTTTGG + Intergenic
931824226 2:65982870-65982892 ATGGTTTAGCACCACCACCTTGG + Intergenic
931952896 2:67385068-67385090 ATGGCTTAGCACCATCTCCTTGG + Intergenic
932072139 2:68631334-68631356 ATGGTTTAGCACCATTCTCTTGG - Intergenic
932360672 2:71103072-71103094 ATGGCGTAGCACCATCCCCTTGG + Intergenic
933402139 2:81811870-81811892 ATGATTTAACACCATCCCCTTGG + Intergenic
933403351 2:81826956-81826978 ATAGTTTACCACCATCCCCTTGG + Intergenic
933475488 2:82784620-82784642 ATGGTTCAGCACCATCCCTTTGG - Intergenic
933484967 2:82909595-82909617 ATGGTTTAGCACCATCACCTGGG + Intergenic
933535884 2:83574087-83574109 ATGGTTTAGTACCATCCTCTTGG - Intergenic
933698098 2:85235406-85235428 TTGGTTTATCACCACCCTCTGGG + Intronic
933989546 2:87624481-87624503 ATAGTTTAGCACTACCCTCTTGG - Intergenic
934050740 2:88208644-88208666 ATGGTTTAGTACCATCCCTTTGG - Intergenic
934621307 2:95810114-95810136 ATGGTTTAGTACTATCTCCTTGG - Intergenic
934694905 2:96392735-96392757 ATGGTTTAGCACCATCTTCTTGG - Intergenic
934812136 2:97288700-97288722 ATGGTTTAGTACTATCTCCTTGG + Intergenic
934825558 2:97419227-97419249 ATGGTTTAGTACTATCTCCTTGG - Intergenic
934922215 2:98353944-98353966 ATTATTTAGCACCACTGCCTTGG - Intronic
934924495 2:98372530-98372552 ATGGTTTAACAGCACAAGCTTGG + Intronic
934926562 2:98385927-98385949 ATGGTTTGGCACCAATTCCTTGG - Intronic
935006545 2:99084351-99084373 ATGGTTTAACACTATCCCCTTGG + Intronic
935158376 2:100505332-100505354 ATGGTTTAGCACCATCTCCTTGG + Intergenic
935160893 2:100528575-100528597 ATGGTTTGGCACCATCCCTTTGG - Intergenic
935239614 2:101167129-101167151 ATGGTTTAGCACCACCTGCTTGG + Intronic
935241414 2:101181530-101181552 ATGGTTTAGCACCATCCTCTTGG - Intronic
935377728 2:102417259-102417281 ATGGTTTGGCACCATCCCTTTGG + Intergenic
935409042 2:102739497-102739519 ATGGTTTAGCCCCATCCTCTTGG + Intronic
935611495 2:105030508-105030530 ATGGTTTAGGACCATGAACTTGG + Intergenic
935930271 2:108116709-108116731 ATGGTTTAGCAGCATCTCATTGG - Intergenic
936085536 2:109465860-109465882 ATGGTTTAACACCGTCTCCTTGG - Intronic
936233279 2:110722891-110722913 TGGCTTTAGCACCATCACCTTGG + Intergenic
936268566 2:111030485-111030507 ATAATTTAGCAACATCACCTGGG - Intronic
936304297 2:111326345-111326367 ATAGTTTAGCACTACCCTCTTGG + Intergenic
936339075 2:111615542-111615564 ATGGTTTAGCACCAACCTCTTGG + Intergenic
936474498 2:112828054-112828076 ATGGTTTAGCACTATCCCTTTGG - Intergenic
936591812 2:113811485-113811507 ATGGTTTAGCACCATCTTGTTGG + Intergenic
936690768 2:114885336-114885358 ATGGTTTAGCATTATCCCCTCGG - Intronic
936874587 2:117172951-117172973 ATGGTTTAGCACCATCTTCTTGG + Intergenic
936955371 2:118017088-118017110 ATGGTTTAGCAACATCCTCTTGG + Intergenic
937146134 2:119646518-119646540 ATGGGTTAGCACCATCTCCTTGG - Intronic
937344449 2:121116017-121116039 TTGGTTTAGTACCATCCCCTTGG - Intergenic
937462655 2:122102854-122102876 ATGGTTTAGCACCGTCCCCGTGG - Intergenic
937462928 2:122104871-122104893 ATGGTTTAGCACCATCTCCTTGG - Intergenic
937498252 2:122449143-122449165 ATGGTTTAGCACCATGTGCTTGG - Intergenic
938057356 2:128226157-128226179 ATGGCTTAGCACCATCCCCTTGG + Intergenic
938141887 2:128801096-128801118 ATGGTTTAGCACCATGGCCTTGG - Intergenic
938730652 2:134144428-134144450 ATGGGTTAGCACCATCCCCTAGG - Intronic
938974017 2:136458490-136458512 ATGGCTTAGCATCATCCCCTTGG - Intergenic
939139940 2:138342865-138342887 ATGGTTTAGCATCATCCCTTTGG + Intergenic
939229241 2:139405713-139405735 ATGGTTTGGCACCATTATCTTGG - Intergenic
939249182 2:139663745-139663767 ATGGTTTAGCACAAACCCCCTGG - Intergenic
939459080 2:142476182-142476204 ATGGTTTAGGACCATCCCCTTGG - Intergenic
939482718 2:142769924-142769946 ATGGTTTGGCACCACCCCCTTGG + Intergenic
939482968 2:142771954-142771976 ATGGTTTAGAATCATCCCCTTGG + Intergenic
939787549 2:146536388-146536410 ATGGTTTAGCACCATCCTCATGG - Intergenic
940127347 2:150341456-150341478 ATGGTTTAGCAGCATCCCGTTGG + Intergenic
940646566 2:156398516-156398538 ATGGTTTAGTACCATCCTCTTGG - Intergenic
940684997 2:156837762-156837784 ATGGTTTAGCACCATCTCCCTGG + Intergenic
941301521 2:163808490-163808512 ATGGTTTAGTACCATCCCCTTGG + Intergenic
941394799 2:164961302-164961324 ATGGTTTAGCACCATCCTCATGG - Intergenic
941984477 2:171496807-171496829 ATGGTTTTGCACCATCCCCTTGG - Intergenic
942237148 2:173921824-173921846 ATGGTTTAGCACCACTGTCTTGG + Intronic
942404730 2:175642134-175642156 ACGGTTTAGCAACATCCCCTCGG - Intergenic
942482544 2:176404704-176404726 GTGGTTTAGCACCATCCTCTTGG - Intergenic
942539742 2:177003154-177003176 ATAGTTTAGCACCACCCTCTTGG - Intergenic
942953405 2:181747900-181747922 ATAGTTTAGCACTATCTCCTTGG - Intergenic
943142725 2:184002746-184002768 ATGGTTTAGCACCATCTCCTTGG - Intergenic
943230534 2:185244976-185244998 ATGGCTTAGCACCATCCCCTTGG + Intergenic
943424069 2:187707354-187707376 ATGGTTCAACACCATCCCCTTGG + Intergenic
943435386 2:187859257-187859279 ATGGTTTAGCACCATTCTCTTGG + Intergenic
943474868 2:188341357-188341379 ATGGTTTAGCATCATCCCCTTGG - Intronic
943491550 2:188560898-188560920 ATGGTTTAGCACCATCTGTTTGG - Intronic
943553446 2:189371007-189371029 ATGGTTTAACACCATCCCCTTGG + Intergenic
943702641 2:191003495-191003517 ATAGTTTAGCACCATCCTCTTGG + Intronic
943859949 2:192848773-192848795 ATGGTTTAGCACCATCCCCTTGG + Intergenic
943912500 2:193586433-193586455 ATGGTTTAGCACCACCCACTTGG + Intergenic
944043700 2:195384484-195384506 ATGGTTTAGTACCATCGCCTTGG - Intergenic
944100703 2:196023120-196023142 ATGGTTTAGCATCATCCTCTTGG + Intronic
944122239 2:196252470-196252492 ATGGTTTCGCACCACTCCCTTGG + Intronic
944311137 2:198235173-198235195 ATGGCTTAGCACCACCCTCTTGG - Intronic
944338446 2:198565857-198565879 ATGGTTTAGCACCATCACCTTGG + Intronic
944390829 2:199217715-199217737 ATGGTTTAGTACCATCCCATTGG + Intergenic
944447711 2:199807981-199808003 ATGGTTTAGTACCATCCTCTTGG + Intronic
944508162 2:200436902-200436924 ATGGTTTAACACCATCCCCTTGG + Intronic
944546673 2:200805633-200805655 GTGCTTTAGCACCAACACTTTGG + Intergenic
944592436 2:201230096-201230118 ATGGGTTAGCACCATCCCTTTGG + Intergenic
945013218 2:205486739-205486761 ATGGTTTAGGACCATCCCCTTGG - Intronic
945084780 2:206119967-206119989 ATGGCTTGGCACCATCACCTTGG + Intronic
945328900 2:208516287-208516309 ATGGTTTAGCACCATCCCCTTGG - Intronic
945368006 2:208979941-208979963 ATGGCTTAGCACCATCCCATTGG + Intergenic
945561924 2:211350116-211350138 ATGGTTTAGCACAATCTCCTTGG + Intergenic
945941086 2:215950906-215950928 ATGGTTTAGCACCATCCACCTGG + Intronic
946141069 2:217691145-217691167 ATGGCTTAGCACCATCCCCTTGG + Intronic
946145884 2:217730687-217730709 ATGGTTTATCACCATCCCCTTGG + Intronic
946483014 2:220074756-220074778 ATGGTTTAAGACCACCATCCAGG + Intergenic
946561747 2:220921832-220921854 ATGGTTTAGCACCATCTCCTTGG - Intergenic
946619740 2:221548120-221548142 ATGGGTTAGCACCATCCTCTTGG + Intronic
946636887 2:221739149-221739171 ATGGTTTAGCACCATCCCCTCGG - Intergenic
946640994 2:221783349-221783371 ATGGCTTAGCACTATCCCCTTGG - Intergenic
946714455 2:222538831-222538853 ATGGTTTAGCACCATCCCCTTGG - Intronic
946801644 2:223423654-223423676 ATGGTTTAGCACCATCCCGTTGG + Intergenic
946819385 2:223614528-223614550 ATGGTTTAGTACCAGCCCCTTGG - Intergenic
946850119 2:223897761-223897783 ATGGTTTAGTGCCATCCCCTTGG + Intronic
946897994 2:224344648-224344670 ATGGCCTAGCACCATCCCCTTGG - Intergenic
947096086 2:226568450-226568472 ATGGTTTAGCACCATCACTCTGG + Intergenic
947101403 2:226625245-226625267 ATGGCTCAGCACCATCCCCTTGG - Intergenic
947253944 2:228140719-228140741 ATGGCTTAGCACCGTCTCCTTGG + Intronic
947256230 2:228167027-228167049 ATGGTTTAGCACCATCCTCTTGG - Intronic
947270873 2:228333476-228333498 ATGATTTAGCACTATCCCCTTGG + Intergenic
947274367 2:228373520-228373542 ATGGTTTAACACCATCTCCCTGG - Intergenic
947403299 2:229749951-229749973 ATGGTTCAGCACCAGCCCCTTGG + Intergenic
947769534 2:232659987-232660009 ATGGTTCTGCACCATCCCCTTGG - Intronic
947954385 2:234175508-234175530 ATGGCTTAGCAACATCCCCTTGG - Intergenic
947965570 2:234278616-234278638 ATGGTTTAGCGCCATCCCTTTGG - Intergenic
948091244 2:235297734-235297756 ATGGCTTAGCACCATCCTCTTGG - Intergenic
948105689 2:235411941-235411963 ATGGTTTAGCACCATCCTCTTGG + Intergenic
948134307 2:235624808-235624830 ATGGTTCAGCACCATCCCCTTGG + Intronic
948215099 2:236222659-236222681 ATGGTTTAGTACCATCCCCTTGG + Intronic
948221636 2:236274439-236274461 ATGGTTTAGCACCGTCCCCTCGG - Intergenic
948224747 2:236300089-236300111 ATGGTTTAGTACCAGCTCCTTGG + Intergenic
948244408 2:236466702-236466724 ATGGCTTAGCACCATCCCCTTGG - Intronic
948321617 2:237074173-237074195 ATGGTTTAGCACCATTGCCTTGG + Intergenic
948343614 2:237276830-237276852 ACGGTTTGGCACCATCCCCTTGG - Intergenic
948661993 2:239513217-239513239 ATGAATTAGCACCATCTCCTTGG + Intergenic
948676099 2:239597601-239597623 ATGGTTTAGTGCCATCCCCTTGG + Intergenic
949061043 2:241957525-241957547 ATGGCTTAGCACCACGGCCTGGG - Intergenic
1168809355 20:694107-694129 ATGGTTTACCACCATCCCCTTGG - Intergenic
1168844937 20:937933-937955 ATGGTTTCACACCATCTCCTTGG + Intergenic
1169051967 20:2586671-2586693 ATGGCTTAGCACTATCCCCTTGG - Intronic
1169164905 20:3414890-3414912 ATGGTTTGGCACCCTCCCCTTGG - Intergenic
1169412238 20:5381613-5381635 ATGGCTTAGCACCATCACCTTGG - Intergenic
1169505887 20:6210950-6210972 ATAGTTTAGCACCATCCTCTTGG - Intergenic
1169511590 20:6269634-6269656 ATGGTTTAGCACCATCACCTTGG + Intergenic
1169635844 20:7690472-7690494 ATGGTTTAGCACTATCCTCTTGG + Intergenic
1169662688 20:7997898-7997920 ATAGTTTAGCACCATCCACTTGG + Intronic
1169741005 20:8894066-8894088 ATGGTTTAGCACCATCCCTTTGG + Intronic
1169745575 20:8939222-8939244 ATGGTTTAGCACCATCCTCCTGG - Intronic
1169860839 20:10150716-10150738 ATGGTATAGCACCATCCCCTTGG - Intergenic
1169940086 20:10927506-10927528 CTGGTTGAGCATCACCTCCTAGG - Intergenic
1170015398 20:11775649-11775671 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1170085278 20:12524549-12524571 ATGGTTTAGCAGCATCCCCTTGG + Intergenic
1170090959 20:12589390-12589412 ATGGTTTAGCGCCATCCGCTTGG - Intergenic
1170482091 20:16775783-16775805 ATGGTTTAGCACCATTCCCTTGG + Intergenic
1170532431 20:17308190-17308212 ACAGTTTAGCACCATCTCCTTGG - Intronic
1170560044 20:17549525-17549547 ATGGTTTGGCACCATCCCTTTGG - Intronic
1170714350 20:18819049-18819071 ATGGCTTAGCACCATCAGCTTGG - Intronic
1171146975 20:22793248-22793270 ATGGTTTAACACCATCCTCTTGG + Intergenic
1171309114 20:24131983-24132005 ATGGTTTAGCACCATCTCGTTGG - Intergenic
1171497942 20:25570337-25570359 ATGGGTAAGCACCATCCCCTTGG + Intronic
1171881314 20:30619344-30619366 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1171954637 20:31451512-31451534 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1172017782 20:31888876-31888898 ATGGTTTGGCAACATCCCCTTGG - Intronic
1172068251 20:32236915-32236937 CTGGCTTAACACCACCAGCTGGG - Exonic
1172226454 20:33308193-33308215 ATGGTTTAGCGCCATCCTCTTGG - Intronic
1172291329 20:33779293-33779315 ATGGTTTAGGACCATCCCCTTGG - Intronic
1172953167 20:38735298-38735320 ATGGCTTAGCACCATCTCCTTGG + Intergenic
1173020477 20:39263703-39263725 ATGGTTTATCACCATCCCCTTGG - Intergenic
1173456504 20:43206699-43206721 ATGGTTTAGCACCACCCTTTTGG - Intergenic
1174715650 20:52755176-52755198 ATGGTTTAGCACCATTCCCTTGG - Intergenic
1174751875 20:53119036-53119058 ATCGTTTAGCTCCATCCCCTTGG - Intronic
1174924873 20:54748339-54748361 ATGGTTTAGCACTATCACCTAGG - Intergenic
1174949657 20:55029971-55029993 ATGGATTACCACCATCTCCTTGG - Intergenic
1174951359 20:55044734-55044756 ATGGCTTAGCACCATCCCCTCGG + Intergenic
1175043184 20:56075626-56075648 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1175096968 20:56548872-56548894 ATGGTTTGGCACCATCCCCTTGG + Intergenic
1175233996 20:57496144-57496166 ATGATTTAGCACCATCCGCTTGG + Exonic
1175292278 20:57883923-57883945 ATGATTCAGCACCATCCCCTTGG + Intergenic
1175328674 20:58147860-58147882 ATGGTTTGGCACCTTCCCCTGGG - Intergenic
1175761434 20:61564420-61564442 ATGGTTTAGCGCCTTCCCCTCGG + Intronic
1176387158 21:6143938-6143960 ATGGTTTAGGACCATCCCCTTGG + Intergenic
1176601757 21:8800608-8800630 GTGGTTCAGCACCATCCCCTTGG - Intergenic
1176626214 21:9094119-9094141 GTGGTTCAGCACCATCCCCTTGG + Intergenic
1176647376 21:9363926-9363948 GTGGTTCAGCACCATCCCCTTGG - Intergenic
1176690740 21:9905128-9905150 ATGGTTTAGCACCATCTCCTTGG - Intergenic
1176789489 21:13302765-13302787 ATGTTTTATCACCATCCCCTTGG + Intergenic
1176886758 21:14265729-14265751 ATGGTGTAGCACCATCCCCCTGG + Intergenic
1177147759 21:17425072-17425094 ATGGTGTCGCACCATCCCCTTGG + Intergenic
1177229789 21:18305047-18305069 AGAGTTGAGAACCACCACCTAGG - Intronic
1177268238 21:18811272-18811294 ATGTTTTAGCACCACCGCCCTGG - Intergenic
1177675604 21:24294754-24294776 ATGGTTCAGTACCATCCCCTTGG - Intergenic
1177725529 21:24962281-24962303 ATGGTTTAACACCTCCTCCTTGG - Intergenic
1177725602 21:24963080-24963102 ATGGTGTAGCACCTCCTCCTTGG + Intergenic
1177770859 21:25514022-25514044 ATGGTTTAACACCATCCCCCAGG - Intergenic
1177882104 21:26706416-26706438 GTGGTTTAGCACCAGCTCCTTGG - Intergenic
1177883195 21:26718495-26718517 ATGGCTTAGCACCAGCCTCTTGG - Intergenic
1178392245 21:32208325-32208347 ATGGTTTAGAACCATCCCCTTGG + Intergenic
1178520418 21:33284660-33284682 ATGGCTTATCACCATCCCCTTGG + Intronic
1178765799 21:35450098-35450120 ATGGTTTAGCGCCATCCCCTCGG - Intronic
1178767298 21:35466430-35466452 ATGGTTTATCACCATCCCCTTGG + Intronic
1178782182 21:35614296-35614318 ATGGTTTAGCACAATCTTCTAGG - Intronic
1179271569 21:39855387-39855409 ATGGTTTTCCCCCACCACCTTGG - Intergenic
1179432492 21:41333370-41333392 ATGGTTTAGCACCATCTTCTTGG + Intronic
1179550266 21:42139419-42139441 ATGATTTAGCACCATCCTCTTGG - Intronic
1179630612 21:42675948-42675970 ATGGTTTAGTGCCATCCCCTTGG + Intronic
1179736315 21:43394314-43394336 ATGGTTTAGGACCATCCCCTTGG - Intergenic
1180093810 21:45545288-45545310 ATGGCTTAGCACCATCACCTTGG + Intergenic
1180153575 21:45965849-45965871 ATGGGTTAGTACCATCCCCTTGG + Intergenic
1180344043 22:11692159-11692181 GTGGTTCAGCACCATCCCCTTGG - Intergenic
1180365542 22:11935065-11935087 GTGGTTCAGCACCATCCCCTTGG + Intergenic
1180946946 22:19700480-19700502 TTGGTTTACCACCATCCCCTTGG - Intergenic
1181383466 22:22525685-22525707 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1181452383 22:23032391-23032413 AAGCTGTAGCCCCACCACCTTGG + Intergenic
1181905898 22:26196109-26196131 ATAGTTTAGCACCATCTTCTTGG + Intronic
1181985090 22:26794897-26794919 ATGGTTCAGAACCATCTCCTTGG + Intergenic
1182844958 22:33422824-33422846 ATGGTTTAGCACCATCACCTTGG - Intronic
1182882163 22:33742989-33743011 ATGGTTTAGCACCATTCTCTTGG + Intronic
1182938449 22:34249839-34249861 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1183218519 22:36496788-36496810 CTGCTCTACCACCACCACCTCGG - Intronic
1183275888 22:36897463-36897485 ATGGTTTAGCACCATCCCCATGG + Intergenic
1183859626 22:40660463-40660485 ATGGTTTAGCACTATCCCCTTGG - Intergenic
1184063042 22:42096553-42096575 ACGGCTTAGCACCATCCCCTTGG + Intergenic
1184464548 22:44661116-44661138 ATGGTTTAGCGCCACCTCCTTGG - Intergenic
1184706962 22:46221223-46221245 ATGGTTTAGCACCATCCTCTTGG - Intronic
1184718419 22:46295361-46295383 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1184915918 22:47568961-47568983 ATGGTTTAGCACCATCCTCTCGG - Intergenic
949196548 3:1316482-1316504 ATGGTTTAGCACTATCTCCGTGG - Intronic
949404908 3:3703899-3703921 ATGGTTTAGCACCATCACTTTGG - Intronic
949494788 3:4621404-4621426 ATGGTTTAGAACCACCTCTTTGG - Intronic
949823630 3:8141365-8141387 ATGGTTCAACACCATCCCCTTGG + Intergenic
949951948 3:9236493-9236515 ATGGTTTAGCACCATCACTTTGG + Intronic
949962067 3:9320396-9320418 ATGGTTTAACACTATCCCCTTGG + Intronic
950150211 3:10680941-10680963 ATGGTTTAGCACCATCTACCTGG + Intronic
950160195 3:10754725-10754747 ATGGTTTAGCACCATCCTCCTGG + Intergenic
950281276 3:11710129-11710151 ATGGTTTAGTGCCATCCCCTTGG - Intronic
950799815 3:15541286-15541308 ATGGATTAGCACCATCCCCTTGG - Intergenic
950996642 3:17505241-17505263 ATGGTTTTGCACCATCCCCTTGG + Intronic
951027314 3:17843764-17843786 ATGGTTAAGCACCATTCCCTTGG + Intronic
951133184 3:19073360-19073382 ATGGCTTAGCACTACCCCCTTGG + Intergenic
951191095 3:19772546-19772568 ATGGCTTAGCACCATCCCCTTGG + Intergenic
951237109 3:20249557-20249579 TTGGCTTAGCACCATCCCCTTGG - Intergenic
951241408 3:20289695-20289717 ATGGCTTAGCACCATCCCCTTGG - Intergenic
951475407 3:23100465-23100487 ATGACTTAGCACCACCTCTTTGG - Intergenic
951494570 3:23312001-23312023 ATGGTTTAATACCATCAACTTGG + Intronic
951673223 3:25208105-25208127 ATGGTTTAGCACCATCCCCTCGG - Intronic
951765576 3:26194796-26194818 ATGATTTAGCACCATCCCGTTGG + Intergenic
951810027 3:26688676-26688698 ATGGTTTAGCACCATCCCCTTGG - Intronic
951936889 3:28032123-28032145 ATGGTTTAGCACCATCCCTTTGG + Intergenic
951937150 3:28034162-28034184 ATGATTTAGCACCACCCCCTTGG + Intergenic
951954137 3:28235805-28235827 ATGCTTTAGCACCATCCTCTTGG - Intergenic
952185437 3:30962846-30962868 ATGGTTTACCACCATCTCCTTGG - Intergenic
952739285 3:36720109-36720131 ATGGTTTAGTACCATCCCCTTGG + Intronic
952807826 3:37374404-37374426 ATGGTTTAACACCATCCCCTTGG - Intergenic
953091163 3:39727267-39727289 ATGGTTTAGTACCATTCCCTTGG - Intergenic
953209696 3:40864692-40864714 GTGGTTTAGCGCCATCCCCTTGG + Intergenic
953519140 3:43624423-43624445 ATGGTTTAGCACCATCCCCTTGG + Intronic
954100007 3:48364301-48364323 ATGGTTTAGTACCATCCACTTGG + Intergenic
954504092 3:51051927-51051949 ATGGCTTAGCCCCATCCCCTTGG - Intronic
954589362 3:51768261-51768283 ATGGTTTAGCATCATCCCCTTGG - Intergenic
954602821 3:51884015-51884037 AGGGTTTAACACCATCCCCTTGG - Intergenic
954926031 3:54235528-54235550 ATGGTTTAGTACCATCCCCTTGG - Intronic
954927906 3:54253513-54253535 ATGGTTTAGTACCATCCCTTTGG - Intronic
955498600 3:59562314-59562336 ATGGTTTAGCGCCTTCCCCTTGG - Intergenic
955551660 3:60091667-60091689 ATGGTTTCGCACCATCCCCTTGG + Intronic
955654508 3:61230265-61230287 ATGGTTTAGCACTATCCTCTTGG + Intronic
955669444 3:61387988-61388010 ATGGTTTAGCACCATCCCCTTGG + Intergenic
955725300 3:61926304-61926326 ATGGTTTAGCACCATCCCCTTGG + Intronic
956214451 3:66834017-66834039 ATGGGTTAGCATCATCTCCTTGG - Intergenic
956489003 3:69751877-69751899 ATGGTTTAGCACTATCCCCTTGG + Intronic
956700920 3:71957774-71957796 ATGGATTAGCATCATCTCCTTGG - Intergenic
956775088 3:72558353-72558375 ATGGTTTAGTACCATCCCCCTGG + Intergenic
956966051 3:74462032-74462054 ATAGTTTAGCACCATCTCTTTGG + Intronic
957088974 3:75709355-75709377 ATGGTTTAGCACCATCCCCTTGG - Intergenic
957273890 3:78065287-78065309 ATGGTTTTGCACCATCCTCTTGG + Intergenic
957285303 3:78209998-78210020 ATGGCTTAGCTCCATCCCCTTGG + Intergenic
957609750 3:82451759-82451781 ATGGCTTAGCACCATCCCCTTGG + Intergenic
957747875 3:84368152-84368174 ATGGTTTAGCACCATCTTCTTGG - Intergenic
957823614 3:85411684-85411706 ATGGTTTAAAAACACCACCAAGG + Intronic
957843569 3:85701231-85701253 ATGGTTTAGCACCATCACTTTGG - Intronic
957868239 3:86051824-86051846 ATGGTTTAGCACTATCTCCTTGG - Intronic
957876234 3:86149939-86149961 ATGGTTTAGCACCACCACCTTGG + Intergenic
958049707 3:88330268-88330290 ATAGTGTAGCACCATCAACTTGG - Intergenic
958163548 3:89849657-89849679 ATGGTTTAGCACCATCCCTTTGG + Intergenic
958253880 3:91302142-91302164 ATGGCTTAGGGCCATCACCTTGG - Intergenic
958557831 3:95703188-95703210 ATGGTTTAGCACCATCCTCTTGG + Intergenic
958693648 3:97500515-97500537 ATGGTTTAGCACTATCCCCCTGG - Intronic
958699127 3:97566250-97566272 ATGGCTTACCACCACCCCCTTGG - Intronic
958822281 3:98989096-98989118 ATGGTTTAGCACCATCTCCTTGG + Intergenic
958841590 3:99211195-99211217 ATGGCTTAGCACCATCCTCTTGG - Intergenic
958969211 3:100592560-100592582 ATGGCTTAGCACAACCCCCTTGG + Intergenic
959301460 3:104607629-104607651 ATGGTTTACCACCATCTCCTTGG + Intergenic
959389473 3:105756904-105756926 ATGGTTTAGCACCATCTCCTTGG + Intronic
959838425 3:110947796-110947818 ATGGTTTGGCACCATTTCCTTGG + Intergenic
959884426 3:111482307-111482329 ATGGCTTAGCACCATCCTCTTGG - Intronic
960014410 3:112870842-112870864 ATGATTTAGCATCATCGCCTTGG - Intergenic
960150767 3:114246520-114246542 ATGGTTTAGCACCATCCCTTTGG + Intergenic
960216437 3:115043905-115043927 ATGGCTTGGCACCATCTCCTTGG + Intronic
960724873 3:120659981-120660003 ATGGCTTAGCACTACCCTCTTGG + Intronic
960787075 3:121385416-121385438 ATGGCTTAGCGCCATCTCCTTGG - Intronic
961370681 3:126427996-126428018 ATGGTGTAGCACCATCCCTTTGG - Intronic
961525614 3:127495390-127495412 ATGGCTTAGCACCATCTCTTTGG - Intergenic
961780667 3:129318421-129318443 ATGGTTTAGCACCATTCCCTCGG + Intergenic
961833469 3:129637634-129637656 ATGGCTTAGCGCCATCCCCTTGG - Intergenic
962388262 3:134950671-134950693 ACGGTTTAGCACCATCCCTTTGG - Intronic
962422897 3:135243664-135243686 ATCCTTTACCACCACCAACTTGG - Intronic
962489348 3:135877182-135877204 ATGGTTTAGCACCGTCTCCTTGG - Intergenic
962865746 3:139446907-139446929 ATGGTTTAGTGCCATCCCCTTGG + Intergenic
963745985 3:149125571-149125593 ATGGTTTAGTACCCTCCCCTTGG + Intergenic
963763628 3:149310083-149310105 ATGGTTTAGTACCATCTCCTTGG + Intergenic
963803150 3:149697370-149697392 ATGGCTTAGCATCATCCCCTGGG - Intronic
964073430 3:152664055-152664077 ATGGCTTAGTACCATCCCCTTGG - Intergenic
964102323 3:153002065-153002087 ATAGTTTAGTAGCACCACTTTGG - Intergenic
964127598 3:153252070-153252092 ATGGCTTAGTACCATCCCCTTGG - Intergenic
964129636 3:153272483-153272505 ATGGTTTAGCACCATCTCTTTGG + Intergenic
964176738 3:153832628-153832650 ATGGTTTAGCGCCATCCCCTTGG - Intergenic
964240016 3:154581430-154581452 ATGGACTAACACAACCACCTTGG + Intergenic
964421262 3:156505925-156505947 ATGGTTTGGCATCATCTCCTTGG - Intronic
964468863 3:157030221-157030243 ATTGCTTAGCACCATCCCCTTGG - Intronic
964470046 3:157043002-157043024 ATGGTTTAGCACCATCCTGTTGG + Intronic
964528691 3:157643954-157643976 ATGGTTTAGTACCATCCCCTTGG - Intronic
964621874 3:158726909-158726931 ATGGTTTGGCACCCTCCCCTTGG + Intronic
964718952 3:159752699-159752721 ATGGATTAGCACCATCCCCTTGG - Intronic
964749791 3:160043666-160043688 ATGGCTTAGCACCATCTCTTTGG + Intergenic
965125292 3:164619830-164619852 GTGGTTTAGCACCATCTCCTTGG - Intergenic
965232680 3:166073108-166073130 GTGGTTTAACACCATCCCCTTGG + Intergenic
965460359 3:168954366-168954388 ATGGTTTAGTACTATCTCCTTGG + Intergenic
965833417 3:172824458-172824480 ATGCTTTAGCACCATCCCCCTGG - Intergenic
965870284 3:173256239-173256261 ATGATTTAGCACCATCCTCTAGG + Intergenic
965938255 3:174143081-174143103 ATGGTTTAGCACCATCCCTGTGG - Intronic
965968484 3:174525499-174525521 ATGGTTTCACACCATCCCCTTGG - Intronic
966296697 3:178432320-178432342 GTGGTTTAACACCATCCCCTTGG + Intronic
966782134 3:183593005-183593027 ATGGGTTAGCAACATCCCCTTGG + Intergenic
966989705 3:185217186-185217208 ACGGTTTAGTACCATCCCCTTGG + Intronic
967014334 3:185468062-185468084 ATGGTTTCGCATCATCTCCTCGG - Intronic
967324390 3:188224795-188224817 ATGGTTTAGCACCATCCTCTTGG - Intronic
967521078 3:190433836-190433858 ATGACTTAGCACCATAACCTTGG + Intronic
967548967 3:190767080-190767102 ATGGTTTAGCATTATCCCCTTGG - Intergenic
967645170 3:191913999-191914021 ATGGTTTAGCATCATTGCCTTGG + Intergenic
967704083 3:192630047-192630069 ATGGTTTCACACCATCCCCTTGG + Intronic
968124480 3:196148411-196148433 ATGGTTTGGCACCATCCTCTCGG + Intergenic
1202739503 3_GL000221v1_random:41061-41083 GTGGTTCAGCACCATCCCCTTGG + Intergenic
968858998 4:3151458-3151480 ATGGTTGAGCACCATCCCCCTGG - Intronic
969082412 4:4629062-4629084 ATGGCTTAGCACCATCACCTTGG + Intergenic
969142658 4:5092755-5092777 ATGGTTTAGCACCATCTCCTTGG - Intronic
969168862 4:5342572-5342594 ATGGTTTAGCACCATCTCCTTGG - Intronic
969175217 4:5393668-5393690 ATGGTTTAGCACCATCCTCTTGG - Intronic
969560782 4:7946485-7946507 ATGGTTTAGCACTAACTCCCTGG - Intergenic
970068643 4:12129031-12129053 ATGGTTTAGCACCATCCCTTTGG + Intergenic
970117782 4:12718619-12718641 ATGGTTTAGCACCATCCTCTTGG + Intergenic
970249650 4:14100891-14100913 ATGGTTTAGCACCAGCTGCTTGG - Intergenic
970344596 4:15141343-15141365 ATGGTTTAGCGCCATCCCCTTGG - Intergenic
970346160 4:15154051-15154073 ATGGTTTAGCACTATTGCCTTGG + Intergenic
970421456 4:15909187-15909209 ATGACTTAGCACCACCGCCTTGG - Intergenic
970801169 4:19975352-19975374 ATGGCTTAGCACCATCCCCTTGG + Intergenic
970828997 4:20313406-20313428 ATGGCTTGGCACCATCCCCTTGG - Intronic
970855922 4:20649367-20649389 ATGGTTTAGCATCATCCTCTTGG + Intergenic
970945148 4:21682256-21682278 ATGGGTTAGCACCATCCCCTTGG - Intronic
971095972 4:23403620-23403642 ATGGTTTAGAACCAACCCTTTGG + Intergenic
971118674 4:23679538-23679560 ATGGTTTAGTGCCATCCCCTTGG + Intergenic
971420490 4:26469733-26469755 ATGGTTTAGCGCCATCCCCGTGG - Intergenic
971562275 4:28095276-28095298 TTGGTTTAGCACCATCTCCTTGG - Intergenic
971804402 4:31336434-31336456 ATGGGTTAGCACCATCCCCTCGG - Intergenic
971837068 4:31781129-31781151 AAGATTTAGCACCATCGCCTTGG - Intergenic
972069406 4:34996506-34996528 ATGGGTTAGCACCATCCTCTTGG - Intergenic
972082591 4:35172209-35172231 ATGGTTTAGTATCATCATCTTGG + Intergenic
972145656 4:36021427-36021449 ATGGTTTGGTACCATCATCTTGG + Intronic
972730539 4:41790381-41790403 ATGATTTAGCACCATCTGCTTGG - Intergenic
972944949 4:44242734-44242756 ATGGTTTAGCACCCTCCCCTTGG + Intronic
973028133 4:45299906-45299928 TTGGTTTAGCACCATCCTCTAGG + Intergenic
973097307 4:46218245-46218267 ATGGCTTAGCACCATCCGCTTGG - Intergenic
973342368 4:49018249-49018271 ATGGTTTAGCACCACACCCTCGG - Intronic
973708607 4:53603714-53603736 ATGATTTAGCACCATCCCCAAGG - Intronic
973780561 4:54284661-54284683 ATGGTTTAGCACCATCCCCTTGG - Intronic
973906435 4:55536439-55536461 ATGGTTTAGTACCATCTCCTCGG + Intronic
974110630 4:57521291-57521313 ATAGTTTAGCACCACTCACTTGG - Intergenic
974254902 4:59438790-59438812 ATGGTTTAGCAACATCTCCTTGG + Intergenic
974339016 4:60589554-60589576 ATGGTTTAGCACCATCCCTTTGG + Intergenic
974468706 4:62291709-62291731 ATGGTTAAGCACCATCCCTTTGG + Intergenic
974575585 4:63715823-63715845 ATGGTTTAGTATCATCCCCTTGG - Intergenic
974575918 4:63721412-63721434 ATGGCTTAGCACCATCCCCTTGG - Intergenic
974670290 4:65021666-65021688 ATGGTTTAGCACCATCCTCTTGG - Intergenic
974788346 4:66651842-66651864 ATGGTTTATCATTACCACTTAGG - Intergenic
974981559 4:68963966-68963988 ATGATTTAGCACAATCCCCTTGG + Intergenic
975252227 4:72193613-72193635 ATCGTTTAGCACCATCTCCCTGG - Intergenic
975252293 4:72194117-72194139 ATGATTTAGCACCATCCGCTTGG + Intergenic
975300084 4:72779913-72779935 ATGGTTTAGCATCAGCTCCTTGG + Intergenic
975607206 4:76167378-76167400 ATGGTTTAGCACCATTCGCTTGG + Intronic
975615060 4:76237854-76237876 ATGATTTAGCCCCAGCCCCTTGG - Intronic
975636682 4:76457237-76457259 ATGGTTTAGCACCATTACCTTGG + Intronic
975796797 4:78014538-78014560 ATGGTTTAGCACCATCTTTTTGG + Intergenic
975835651 4:78419932-78419954 ATGGTTTAACACCATCCCCCTGG - Intronic
975946698 4:79715108-79715130 ATGGCTTAGCACCACCCGCTTGG - Intergenic
976013119 4:80516595-80516617 ATGGTTTAGCACCATCTTCTTGG - Intronic
976262551 4:83159478-83159500 ATGGCTTAACACCATCTCCTTGG - Intergenic
976306087 4:83560740-83560762 ATGGTTCAGCACCATCCCCATGG + Intronic
976542398 4:86293826-86293848 ATGGATTAGCACCATCCTCTTGG - Intronic
976683817 4:87788215-87788237 AAGGTTCAGCACCACCACAGGGG + Intergenic
976822128 4:89218328-89218350 ATGGTTTAGCACCATCCTTTTGG + Intergenic
976985526 4:91291655-91291677 ATGGTTTAGCACCGTCCCCTTGG - Intronic
977426829 4:96876955-96876977 ATGGTTTAGTGCCACTCCCTTGG - Intergenic
977514026 4:97997488-97997510 ATAGTTTAGCACCACCCCCTTGG - Intronic
977630811 4:99240338-99240360 GTGGTTTAGCACCATCACTTTGG - Intergenic
977707513 4:100087871-100087893 ACGGTTTAGTACCATCCCCTTGG - Intergenic
977719990 4:100228901-100228923 ATGGTTTGGCACCACCCCCTTGG + Intergenic
977874006 4:102128190-102128212 ATGGTTTAGCACCATCCCCTTGG + Intergenic
978284558 4:107060684-107060706 ATGCTTTAACACCACCACCTTGG - Intronic
978465579 4:109005291-109005313 ATGGTTTAGCACCACAACCTTGG - Intronic
978528722 4:109693017-109693039 ATGGTTTAGCATCATCCTCTTGG + Intronic
978540631 4:109813146-109813168 ATGGCTTAGCACCATCCCCTTGG - Intergenic
978560540 4:110029196-110029218 ATGGTTTAGCTCCATCTCCTTGG + Intergenic
978667330 4:111199955-111199977 ATGGCTTAGCACCATCTCCTTGG + Intergenic
978690559 4:111504452-111504474 GTGGTTTAGCACCATCCCATTGG + Intergenic
978872314 4:113594207-113594229 ATGGTTTAGCACCATCCTCTTGG - Intronic
979027463 4:115595896-115595918 ATGGTTTAGCGCCATCCCTTTGG + Intergenic
979049200 4:115909162-115909184 ATGGTTTATCACCATCTCCTTGG - Intergenic
979253662 4:118590335-118590357 ATGGTTTAGCACCATCCCCTTGG + Intergenic
979552171 4:122003419-122003441 ATGGTTTACTATCACCACCCGGG - Intergenic
979602108 4:122597257-122597279 ATGGTTTAGCACCATCCCCTTGG - Intergenic
979602819 4:122604793-122604815 ATGGTCTTGCTCCATCACCTAGG - Intergenic
979677959 4:123430240-123430262 ATGGCCTAGCACCATCCCCTTGG - Intergenic
979702925 4:123688518-123688540 ATGGTTTAGCACCAGCTCTTTGG - Intergenic
980096368 4:128495257-128495279 ATGGTTTAGCACCATTCTCTTGG + Intergenic
980287852 4:130804667-130804689 ATGGTTTAGTACCACCCCATTGG - Intergenic
980363316 4:131765356-131765378 ATGGTTTAGCACCATCTCCTTGG - Intergenic
980422603 4:132583808-132583830 ATGGTTTACCACCATCCCGTTGG + Intergenic
980700958 4:136429290-136429312 ATGGTTTAGCACCATCCTGTTGG + Intergenic
980749736 4:137072621-137072643 ATGGGTTAGCACCATTATCTAGG + Intergenic
980786747 4:137565902-137565924 ATGGCTTAGCACCTTCCCCTGGG + Intergenic
980849449 4:138362923-138362945 ATGGTTTAACACCATCCCTTTGG - Intergenic
980898373 4:138880904-138880926 ATGGTTTAGCACCATCCTCTTGG + Intergenic
980910416 4:138988966-138988988 ATGGGCTAGCACCATCCCCTTGG + Intergenic
980970685 4:139564530-139564552 ATGGTTTAGCACCATCATTCTGG - Intronic
981239986 4:142465755-142465777 ATGGCTTAGCAACATCCCCTTGG + Intronic
981240245 4:142467843-142467865 ATGGCTTAGCACCACTCTCTTGG + Intronic
981352578 4:143750040-143750062 ATGGTTTAGCACCATCTCCTTGG + Intergenic
981442324 4:144797281-144797303 ATGGCTTAGCATCACCCCCTTGG + Intergenic
981478663 4:145213376-145213398 ATGGCTTAACACCATCTCCTTGG + Intergenic
981588690 4:146332444-146332466 ATTGTTTAGCACCATCCCTTTGG + Intronic
981776882 4:148378524-148378546 ATGGTTTGGCACCATCCCTTTGG + Intronic
981842840 4:149132458-149132480 ATGTCTTAGCACCATCCCCTTGG + Intergenic
982093312 4:151898596-151898618 ATGGTTTAGCACCATCCTCTTGG - Intergenic
982159367 4:152552515-152552537 ATGGTCTAGTACCACCAACCTGG + Intergenic
982178965 4:152732429-152732451 ATGGTTTGACACCAGCCCCTTGG + Intronic
982188940 4:152834153-152834175 ATGGTTTAACACCACTCCCTTGG - Intronic
982189187 4:152835987-152836009 ATGGTTTAGGACCATCCCCTTGG - Intronic
982214535 4:153069246-153069268 ATGGTTTAGTGCCATCCCCTTGG + Intergenic
982386089 4:154803922-154803944 ATGGTTTAGCACCATTCCCTTGG + Intronic
982391059 4:154864174-154864196 ATGGTTTAGCACCATTCTCTTGG - Intergenic
982571006 4:157050707-157050729 ATGGTTTAGCACTATCCCCTCGG - Intergenic
982777739 4:159459213-159459235 ATGGCTTAGTGCCACCCCCTTGG + Intergenic
982856689 4:160391779-160391801 GTGGCTTAGCACCATCTCCTTGG - Intergenic
983075050 4:163316198-163316220 ATGGTTTAGCACCACCCTCTTGG - Intergenic
983075308 4:163318238-163318260 ATGGTTTAGCACCATCCTCTTGG - Intergenic
983147084 4:164229856-164229878 ATGGTTTAGCATCATCACCTTGG - Intronic
983195177 4:164798838-164798860 ATGGTTTAACACCATCCCCTCGG + Intergenic
983540130 4:168900161-168900183 ATGGTTTAGCACCATCCCCTTGG - Intronic
983611959 4:169656440-169656462 AAGGTTTAGCACCATCCACTTGG - Intronic
983698243 4:170559364-170559386 ATGGTTTAGCACTATCCCCGTGG + Intergenic
984213188 4:176875975-176875997 ATGGTTTAGCACCATCTCCTTGG + Intergenic
984480799 4:180298780-180298802 ATGGTTTAGCACCATCTCTTTGG + Intergenic
984527756 4:180876764-180876786 ATGGTTTAGCGCTATCCCCTTGG + Intergenic
985060469 4:186072674-186072696 ATGGTTCAGCACCACCCCCTCGG - Intronic
1202762465 4_GL000008v2_random:124042-124064 GTGGTTCAGCACCATCCCCTTGG - Intergenic
985944900 5:3173023-3173045 ATGGTTCAGCACCATCCCCTGGG + Intergenic
985992793 5:3577223-3577245 ATGGTTTGGCACCATCCCTTTGG + Intergenic
986360848 5:6976334-6976356 AGGGTTTAGCACCATCCCCTTGG + Intergenic
986548176 5:8922808-8922830 ATGGTTTAACACCACTACCTTGG + Intergenic
986552892 5:8978539-8978561 ATGGTTTAGCATCGTCCCCTCGG + Intergenic
986742292 5:10714731-10714753 ACGGTTTAGTACCACCCCCCTGG + Intronic
986802892 5:11279904-11279926 ATGGTTTAGCACCATCCTCTTGG - Intronic
986940671 5:12945579-12945601 ATGGTTTAGCCCCATCCCCTTGG + Intergenic
987262617 5:16219013-16219035 ATGGTTTAGTACCATCAGCTTGG + Intergenic
987289407 5:16494452-16494474 ATGGTTTAGCACCATCCCCTTGG + Intronic
987397875 5:17443007-17443029 ATGGTTTAGGACCATCCCTTTGG - Intergenic
987432859 5:17857833-17857855 ATGGTTTAGTACCATGCCCTTGG + Intergenic
987463586 5:18245402-18245424 ATGGGTTAGCACCATCCCCTTGG + Intergenic
987501070 5:18709871-18709893 ATGGGCTAGCACCATCCCCTGGG - Intergenic
987553378 5:19413010-19413032 ATAGTTTAGCACCATCTTCTTGG + Intergenic
987586189 5:19859793-19859815 ATGCTGTAGCCCAACCACCTTGG + Intronic
987689098 5:21244205-21244227 ATGGTTTAGCACCATCCCCTTGG + Intergenic
987796320 5:22631889-22631911 ATGGTTTAACACCGACCCCTTGG - Intronic
987981935 5:25096829-25096851 ATGGTTTACCATCATCCCCTTGG + Intergenic
988146752 5:27319068-27319090 ATGGTTTAGCGCCATTCCCTTGG - Intergenic
988455987 5:31387805-31387827 ATGGTTTAGCACCATGCTCTTGG - Intergenic
988549239 5:32185444-32185466 ATGGTTCAGCACCATTCCCTTGG + Intergenic
988635229 5:32976659-32976681 ATGGTTTAACACCATCCCCTTGG + Intergenic
988647416 5:33109322-33109344 ATGGTTTAACACCATCCCTTTGG + Intergenic
988850955 5:35180324-35180346 TTGGTTTAGCACCATTCCCTTGG + Intronic
988936800 5:36091604-36091626 ATGGTTTAGCACTATCCCCTTGG + Intergenic
989150983 5:38299532-38299554 ATGGCTTAGCACCATTGCCTTGG + Intronic
989375225 5:40754109-40754131 ATGGTTGAGAGCCACCACCTTGG - Intronic
989448062 5:41554273-41554295 ATGGCTTAGCACCATCCCCTTGG + Intergenic
989497299 5:42124276-42124298 ATGGTTTAGCACTATCTCATTGG - Intergenic
990095504 5:52107368-52107390 ATAGTTTAGCACCATCCCCATGG - Intergenic
990318813 5:54609886-54609908 ATGGTTTAGCATCATCTGCTTGG + Intergenic
990402426 5:55452246-55452268 ATGGTTTAGTGCCATCCCCTTGG + Intronic
990569548 5:57064414-57064436 ATGGATTAGCACCATCCCCTCGG + Intergenic
990583194 5:57184551-57184573 AGGGCTTAGCACCAACCCCTTGG - Intronic
990628211 5:57638164-57638186 ATGGTTTAGCACTATCCACTTGG + Intergenic
990679328 5:58223351-58223373 ATGGTTTAGTATCATCCCCTTGG + Intergenic
991057866 5:62339304-62339326 ATGGTTTAGCACCATCCCCTTGG - Intronic
991085666 5:62646579-62646601 ATGGTTTAGCACCATCCCCATGG - Intergenic
991249218 5:64541290-64541312 ATGGTTTAGCACCATCCCCTTGG - Intronic
991259717 5:64653586-64653608 ATGGCTTAGCACCATCCCCTTGG + Intergenic
991369235 5:65901072-65901094 ATAGTTTAGCACCATCCACTTGG - Intergenic
991429660 5:66531059-66531081 ATGATTTAGCACCAACTCCTTGG - Intergenic
991562802 5:67972325-67972347 ATGGTTTAGCACCATCCTGTTGG + Intergenic
991938733 5:71829515-71829537 ATGGTTTAGTACCATCCCCTTGG - Intergenic
992014696 5:72564004-72564026 ATGATCTAGCACCATCCCCTTGG - Intergenic
992059643 5:73029819-73029841 ATGGCTTAGCATCATCCCCTTGG - Intronic
992070318 5:73142276-73142298 ATGGTTTAGCACTATCCCCTTGG - Intergenic
992134823 5:73734024-73734046 ATGGTTTAGCACCATCCTTTTGG - Intronic
992252921 5:74893847-74893869 ATGGCTTAGCACCATTCCCTTGG - Intergenic
992448350 5:76853885-76853907 ATGGGTTAGCACCATCCCCTTGG + Intronic
992570135 5:78046781-78046803 TTGGTGTAGCAAAACCACCTTGG - Intronic
992791146 5:80215180-80215202 ATGGTTTACCACCATCCACTTGG + Intronic
993005634 5:82425584-82425606 ATTGTTTAGCACCATCTTCTTGG - Intergenic
993017024 5:82545536-82545558 ATGGTTTAGCACCATCCTCTTGG + Intergenic
993045096 5:82857615-82857637 ATGGTTTACCACTATCCCCTTGG + Intergenic
993047100 5:82880406-82880428 AAGATTTAGCACCATCTCCTTGG - Intergenic
993234707 5:85289571-85289593 CTGGTTTAGCACCATATCCTTGG - Intergenic
993344834 5:86769927-86769949 ATGGTTTAGCATCATCCCCTTGG - Intergenic
993938606 5:94032447-94032469 ATGGTTTAGCACCATTCCCGTGG - Intronic
994338528 5:98598535-98598557 ATGGCTTAGCACCATCCCCTTGG + Intergenic
994474612 5:100250742-100250764 ATGGTTTAGCACCATCCCCCTGG + Intergenic
994558735 5:101339161-101339183 CTGGTTTAGCGCCAACCCCTTGG - Intergenic
994693066 5:103042048-103042070 ATGGTTTAGCACCATCCCCTTGG + Intergenic
994854456 5:105099084-105099106 ATGGTTTAGCATCATCCCCTTGG + Intergenic
995117583 5:108499407-108499429 ATGATTTAACACCATCCCCTTGG + Intergenic
995250319 5:109985613-109985635 ATGGTTTACCACCATCACCTTGG - Intergenic
995414323 5:111891815-111891837 ATGGTTCAGCACCATGCCCTTGG - Intronic
995561660 5:113388488-113388510 ATGGTTGAGCACCATCCCCTTGG + Intronic
995595817 5:113746641-113746663 ACAGTTTAGCACCATCCCCTTGG - Intergenic
995683260 5:114744057-114744079 ACAGTTTAGCACCAAAACCTTGG + Intergenic
995683584 5:114746436-114746458 ATGGTTTAGCATTATCCCCTTGG + Intergenic
995857433 5:116608107-116608129 ATGGTTTAGCACCATCCTCTTGG - Intergenic
995927314 5:117389852-117389874 ATGGGTTAGCACCATCCCCTCGG + Intergenic
995966536 5:117914375-117914397 ATGGTTAAGCACCATCCCCTAGG + Intergenic
996226540 5:121006526-121006548 ATGGTTTAGCACCATGCCCCTGG - Intergenic
996251644 5:121342425-121342447 ATGGTTTAGCCTCACGCCCTTGG - Intergenic
996338083 5:122406566-122406588 ATGGTTTAGCGCCATCTCCTTGG + Intronic
996593799 5:125178679-125178701 ATGGTTTTGCACCATCCTCTTGG + Intergenic
996602191 5:125277319-125277341 ATGGTTTAGCGCCATCCTCTTGG + Intergenic
996615426 5:125435751-125435773 ATGGTTTAGCACCATCCTCTTGG - Intergenic
996674346 5:126157095-126157117 ATGGCTTAGCACCATCTCCTTGG + Intergenic
996701201 5:126451819-126451841 ATGGGTTTGCACCATCCCCTTGG + Intronic
996777399 5:127147508-127147530 ATAGTTTAGCACCATCCCCTTGG - Intergenic
996828207 5:127709320-127709342 ATGGTTTAGCCCCATCCCCTTGG - Intergenic
996993598 5:129667508-129667530 ATGGTTTAGCACCATCCTCTTGG + Intronic
997030136 5:130117954-130117976 ATGGCTTAGCACCATCCCTTCGG + Intronic
997032304 5:130145081-130145103 ATGGTTTAGCACCAGCCCCTTGG - Intronic
997068847 5:130594828-130594850 ATGGTTTAGCACTATCCCCTTGG + Intergenic
997124258 5:131209952-131209974 ATGGCTTAGCACCATCACCTTGG + Intergenic
997188140 5:131901976-131901998 GTGCTTTAGCACCACCCTCTTGG + Intronic
997222946 5:132184319-132184341 ATGGTTTAGCACCATTCCCTTGG - Intergenic
997291424 5:132738430-132738452 ATGTTTTAGCACCAGCACTCTGG - Intergenic
997576024 5:134977989-134978011 ATGGTTTAGCACCATTCCATTGG - Intronic
997620275 5:135284699-135284721 ATGGCTTAGCACCATCCCCTTGG + Intronic
997724900 5:136112371-136112393 ATGGTTTAGCACCATCCTCTTGG + Intergenic
997779749 5:136644639-136644661 ATGGTTTAGTACCATCCTCTTGG + Intergenic
997850876 5:137331722-137331744 GTGGCTTAGCACCATCCCCTCGG - Intronic
998047300 5:138998705-138998727 ATGGTTTAGCACCACTTCCTTGG - Intronic
998125770 5:139620085-139620107 ATGGTTTAGCACGACCCCTTTGG - Intronic
998442462 5:142173932-142173954 ATGGGTTGGCACCATCCCCTTGG - Intergenic
998874023 5:146581383-146581405 ATGGTTTAGCACCATCTTCTTGG - Intronic
999341082 5:150773453-150773475 ATGGTTTAGTGCCATCCCCTTGG + Intergenic
999416640 5:151403381-151403403 ATGGTTTAGTACCATCCCCTTGG + Intergenic
999841462 5:155432255-155432277 ATGGTTAAGCACCATCCCTTTGG + Intergenic
999906012 5:156142064-156142086 ATGGTTTAGCAGCATCACCTTGG + Intronic
999906395 5:156145147-156145169 ATGATTTAGCACCATCACCTTGG + Intronic
1000106712 5:158066831-158066853 ATGGCTTAGCACCATCCCCTTGG - Intergenic
1000243440 5:159429538-159429560 ATGGTTTAGCACCATCTCCTTGG - Intergenic
1000401986 5:160838872-160838894 GTGGTTTAGCACCAACCTCTTGG + Intronic
1000495071 5:161972240-161972262 ATGATTTAACACCATCTCCTTGG + Intergenic
1000567461 5:162867580-162867602 ATGTTTTAGCACCGTCCCCTTGG + Intergenic
1000646834 5:163769646-163769668 ATGGTTCAGCACCATGCCCTTGG - Intergenic
1000668862 5:164034698-164034720 ATGGTTTAGCACCTTCCCCTTGG - Intergenic
1000677023 5:164133299-164133321 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1001471128 5:172013484-172013506 AATGTTTAGCATCAGCACCTTGG - Intergenic
1001471526 5:172016775-172016797 ATGGTTTAGCACTAACCCTTCGG + Intergenic
1001891283 5:175341251-175341273 ATGGTTTTACACCATCCCCTTGG - Intergenic
1002002661 5:176206981-176207003 ATGGTTTAGCACCATTCCCGTGG - Intergenic
1002003148 5:176209928-176209950 ATGGTTTAGCACAATCCCCTTGG - Intergenic
1002006149 5:176236776-176236798 ATGGTTTAGTACCATCCCTTTGG - Intergenic
1002018374 5:176344735-176344757 ATGGTTGAGCACCATCCCCTTGG - Intronic
1002220231 5:177673861-177673883 ATGGTTTAGTACCATCCCTTTGG + Intergenic
1002223310 5:177701022-177701044 ATGGTTTAGTACAATCCCCTTGG + Intergenic
1002223938 5:177704636-177704658 ATGGTTTAGCACTATCCCCGTGG + Intergenic
1002317699 5:178354521-178354543 ATGGTTTAACACCATCCTCTGGG + Intronic
1002696592 5:181096159-181096181 ATGGTTTAGCACCACGGCCTTGG - Intergenic
1002698030 5:181103214-181103236 ATGGTTTAGCACCACGGCCTTGG + Intergenic
1003168818 6:3704265-3704287 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1003671182 6:8161897-8161919 ATGGTTTAGCTCCATCCCCTTGG - Intergenic
1003761227 6:9180935-9180957 ATAGTTTAGCACCATCGCCTTGG - Intergenic
1003986921 6:11444476-11444498 ATGGTTTAGTACCATCCCCTTGG - Intergenic
1004165741 6:13255259-13255281 ATGGGTTAGCACCTTCCCCTTGG - Intronic
1004166034 6:13257263-13257285 ATGGTTTAGGACCATTCCCTTGG - Intronic
1004284477 6:14307980-14308002 ATGGTTTAGCACCATCTCCTCGG + Intergenic
1004613968 6:17272167-17272189 ATGGCTTAGCACCATCTTCTTGG - Intergenic
1004695191 6:18026751-18026773 ATGGCTTAGCACCATCCCCTTGG - Intergenic
1004700717 6:18077040-18077062 ATGGTTCAGCACCATCTCCTTGG - Intergenic
1004778860 6:18882259-18882281 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1004793316 6:19052758-19052780 ATGGTTTAGCACCTTCTCCTTGG - Intergenic
1005149293 6:22730304-22730326 ATGGTTTGGCACCATCCCCTTGG + Intergenic
1005423217 6:25674060-25674082 ATGGTTTAGCACCATCCCCTTGG - Intronic
1005669966 6:28095456-28095478 ATGGTTTAGCACCACCTTCTTGG + Intergenic
1005908055 6:30283144-30283166 ATGGTTTAACACCATCCCCCTGG - Intergenic
1005927702 6:30457546-30457568 ATGGTTTAGCACCGTCCCCTTGG - Intergenic
1006308045 6:33236759-33236781 ATGGTTTAGCACCATCCTCCTGG + Intergenic
1006462212 6:34167589-34167611 ATGGTTTAGCGCCATCCCTTTGG + Intergenic
1007057618 6:38903435-38903457 ATGGCTTAGCACTATCCCCTTGG - Intronic
1007209102 6:40177394-40177416 ATGGCTTAGCACCATCCTCTTGG - Intergenic
1007361675 6:41361128-41361150 ATGGTTTAGCACCATTATCTTGG + Intergenic
1007898839 6:45391244-45391266 ATGGCTTGGCACCATCCCCTTGG + Intronic
1008097199 6:47351186-47351208 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1008226303 6:48920792-48920814 ATGGCTTAGCACCATCCTCTTGG + Intergenic
1008277874 6:49562052-49562074 ATGGCTTAGCACCATCCCCTTGG + Intergenic
1008401493 6:51068731-51068753 ATAGTTTAGCACCATTCCCTTGG - Intergenic
1008584267 6:52934798-52934820 ATGGTTTAGCACCATTCCCTTGG + Intergenic
1008652727 6:53579593-53579615 ATGGTTTAGCACGATCCCGTTGG - Intronic
1008871638 6:56279090-56279112 ATGGTTTAGCACCATCCTCTTGG + Intronic
1008898271 6:56582296-56582318 ATGGTTTACCATCATCATCTTGG + Intronic
1009038017 6:58141441-58141463 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1009038266 6:58144728-58144750 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1009213809 6:60895077-60895099 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1009214057 6:60898358-60898380 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1009358972 6:62791121-62791143 ATGGTTTAACACCATCTTCTTGG - Intergenic
1009460957 6:63912691-63912713 ATGGTTTACCACCATCCCCTGGG + Intronic
1009649225 6:66451694-66451716 ATGGTTCAGCACCATCCCTTTGG + Intergenic
1009696372 6:67109242-67109264 ATAGCTTAGCACCATCCCCTTGG + Intergenic
1009804503 6:68585618-68585640 ATGGTTTAGCACTATTCCCTTGG + Intergenic
1009813640 6:68702303-68702325 ATGGTTTAGTACCATCCCCTTGG - Intronic
1010009913 6:71037768-71037790 ATGGTCTAGCACCATCCCCTTGG - Intergenic
1010012438 6:71064472-71064494 ATGGTTTAGAACCATCCCCTTGG - Intergenic
1010202441 6:73294804-73294826 ATGGTTTAGCACCATCCACTTGG + Intronic
1010341537 6:74759190-74759212 ATGGTTTAGCACTCTCCCCTTGG + Intergenic
1010403415 6:75474828-75474850 ACAGTTTAGTACCATCACCTTGG + Intronic
1010517605 6:76791782-76791804 ATGGTTTAGCACAATCCCCTTGG - Intergenic
1010536402 6:77036840-77036862 ATGGTTTAGTACCATCCCCTTGG + Intergenic
1010735124 6:79435545-79435567 ATGGTTTAGCATCATCCGCTTGG + Intergenic
1010875778 6:81103699-81103721 ATGGTTTAGCACCATCACTTTGG + Intergenic
1010988158 6:82449869-82449891 TTGGTTTAGCACCATCCCCTTGG - Intergenic
1010990745 6:82477467-82477489 ATGGCTTAGAACCATCCCCTTGG - Intergenic
1011041398 6:83033508-83033530 ATGGTTTAGCACCATCCCCTTGG + Intronic
1011118639 6:83925298-83925320 ATGGTTTAGGACCACCCTCTTGG - Intronic
1011172107 6:84516696-84516718 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1011264460 6:85500443-85500465 ACGGTTTAGTACCATCCCCTTGG + Intergenic
1011324788 6:86138474-86138496 ATGGTTTAGCACAATCTTCTTGG + Intergenic
1011519029 6:88183997-88184019 ATGGTTTAGCACCATTTCCTTGG + Intergenic
1011544353 6:88467615-88467637 ATAGTTTAGCACCATCCTCTTGG + Intergenic
1011645665 6:89455593-89455615 ATGGTTTAGCACCGTCCTCTTGG + Intronic
1011849027 6:91603063-91603085 ATGCTTTAGTACCACCCTCTTGG - Intergenic
1012017813 6:93874267-93874289 ATGGTTTAACACCATCCCCTTGG + Intergenic
1012039583 6:94186737-94186759 ATGGTTTAGCACCATTCCTTTGG - Intergenic
1012464545 6:99502737-99502759 ATGGTTTAGCTCCATCACTTTGG + Intronic
1012499155 6:99869520-99869542 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1012564366 6:100628489-100628511 ATGGCTTAGCACCATCCTCTTGG + Intronic
1012674790 6:102101773-102101795 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1012734787 6:102925278-102925300 ATGGTTTAGCACCATTCCCTTGG + Intergenic
1012766979 6:103379758-103379780 ATGGTTTAGCACCAGCTCCTTGG - Intergenic
1013315584 6:108939385-108939407 ATGGGTTAGCACCATCCCCCTGG + Intronic
1013394218 6:109718231-109718253 ATGGTTTACAACCACCCCTTTGG - Intronic
1013473025 6:110482364-110482386 ATAGTTTAGCACCAACATCTTGG - Intergenic
1014099028 6:117489312-117489334 ATGGCTTGGCACCATCCCCTTGG - Intronic
1014107641 6:117584794-117584816 ATGGTTTAGCACCATCCCCTTGG + Intronic
1014247863 6:119085954-119085976 ATGGGTTAGCACCATCCCCTTGG - Intronic
1014328369 6:120028167-120028189 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1014415391 6:121177235-121177257 ATGGTTTAGCACCATCCCCTTGG + Intronic
1014509760 6:122306793-122306815 ATGGTTTAGTACCATCTTCTTGG + Intergenic
1014524869 6:122490509-122490531 GTGGTTTAGCACCATCCTCTCGG + Intronic
1014935846 6:127383860-127383882 ATGGCTTAGCTCCATCTCCTTGG - Intergenic
1014937437 6:127400710-127400732 ATGGTTTAGCACCATTCTCTTGG - Intergenic
1015045429 6:128770158-128770180 ATAATTTAGCACCATCCCCTTGG - Intergenic
1015059728 6:128948686-128948708 ATGGTGTAGCACCATCCCCTTGG + Intronic
1015104806 6:129523377-129523399 ATGCTTTAGTACCACCCCGTTGG - Intergenic
1015196434 6:130529072-130529094 ATGGTTTAGCACCGTCCCCTTGG + Intergenic
1015280935 6:131433443-131433465 ATGGTTTAACACCATCCCCTTGG + Intergenic
1015286291 6:131489869-131489891 ATGGTTTAGCCCCATCCCCTTGG - Intergenic
1015311119 6:131768181-131768203 ATGGTTTAGCACCATCCTCCTGG + Intergenic
1015329564 6:131961701-131961723 AAGGTTTAGCACCATCACCCTGG + Intergenic
1015477661 6:133671617-133671639 ATGGTTTATCACCATCCCCTTGG - Intergenic
1015560369 6:134508849-134508871 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1015798148 6:137033482-137033504 GTGGTTTAGCACCACCCGCTTGG + Intronic
1015907384 6:138130815-138130837 ATGGTTTATCACCATCTTCTTGG - Intergenic
1016131209 6:140474218-140474240 ATGGTGTAGCACCATCACCTTGG - Intergenic
1016674883 6:146752331-146752353 ATAGTTTAGCACCATCTACTTGG - Intronic
1016683098 6:146853034-146853056 ATGGTTTGGCACCATCCCCTTGG - Intergenic
1016700361 6:147047618-147047640 ATGGCTCAGCACCATCCCCTTGG + Intergenic
1016778875 6:147936521-147936543 CTGGTTTAGCACTATCCCCTTGG - Intergenic
1016889683 6:148993667-148993689 ATGGTTTAGCAGCGACTCCTTGG + Intronic
1017018982 6:150125060-150125082 ATAGTTTAGCACCATCCTCTTGG + Intergenic
1017047115 6:150357027-150357049 ATGGCTTAGCACCATCACCTTGG + Intergenic
1017166486 6:151412856-151412878 GTGGTTTGGCACCATCCCCTTGG - Intronic
1017314903 6:153019551-153019573 ATGCTTTAGCACCATCTTCTTGG + Intronic
1017357230 6:153523988-153524010 ATGGTTTAGTGCCATCCCCTTGG - Intergenic
1017552372 6:155522789-155522811 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1017925272 6:158906431-158906453 ATGGTTTAGCATCATCCTCTTGG + Intronic
1017953882 6:159162072-159162094 ATGATTCAGCACCATCCCCTAGG - Intergenic
1018051810 6:160015799-160015821 ATGGTCTAGCACCATCCCCTTGG + Intronic
1018425248 6:163674036-163674058 ATGGTTTAGCACCATCCTCTAGG - Intergenic
1018535141 6:164811458-164811480 AAGGATTAGTACCACCACCAAGG - Intergenic
1019141262 6:169945402-169945424 ATGGTTTAGTGCCACCCCCTTGG - Intergenic
1019798618 7:3071312-3071334 ATGGTTTTGCACCATCCCCTTGG - Intergenic
1020279011 7:6640771-6640793 ATGGTCTAGCACCGTCCCCTTGG + Intronic
1020495456 7:8846073-8846095 ATGGTTTAGCACTGTCCCCTTGG + Intergenic
1020527597 7:9282281-9282303 ATGGTTTAGCATCATTTCCTTGG - Intergenic
1020534903 7:9384787-9384809 ATGGCTTAGCACCGTTACCTTGG + Intergenic
1020557419 7:9688350-9688372 ATGGTTTAGAACCAACCCCTTGG + Intergenic
1021133594 7:16940173-16940195 ATGGTTTAGCACCGTCTCCTTGG + Intergenic
1021758697 7:23882042-23882064 ATAGTTTAGCACCATCTTCTTGG - Intergenic
1021817301 7:24460192-24460214 ATGGTTTAGTACCATCCCCTTGG - Intergenic
1022421883 7:30230950-30230972 ATGGTTTAGTACCATCCCTTTGG + Intergenic
1022437432 7:30402957-30402979 ATGGTTTAGCATTATCCCCTTGG + Intronic
1022649671 7:32262845-32262867 AAGGTTTAGCCCCTACACCTAGG - Intronic
1022669313 7:32441032-32441054 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1022753028 7:33252196-33252218 ATGGCTTAGCACCATCCCCTTGG - Intronic
1023034010 7:36115142-36115164 ATGGTTTAGCAGCATCCTCTTGG - Intergenic
1023706178 7:42943873-42943895 ATGGTTTAGCACCATCTTCTTGG + Intronic
1023707514 7:42957236-42957258 ATGGCTTAGCACCACCCACTTGG + Intergenic
1023789308 7:43739425-43739447 ATGGTTTAGCACCATTCTCTTGG - Intergenic
1023854685 7:44175544-44175566 ATGGTTTAGTGCCATCCCCTTGG - Intronic
1024147901 7:46535992-46536014 ATGATTTAGCACCATCCCCTTGG + Intergenic
1024575638 7:50761807-50761829 ATGGTTTAGCACCATCCTCGTGG + Intronic
1024586282 7:50844741-50844763 ATAGTTTAGCACCATCCCCTTGG + Intergenic
1024661889 7:51503560-51503582 ATGGGTTAGCACCATCCCCTCGG - Intergenic
1025937613 7:66049708-66049730 ATGGTATAGCACCATCCCTTTGG - Intergenic
1026104255 7:67408688-67408710 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1026198865 7:68196598-68196620 ATGGTTTAACACCATCCACTTGG - Intergenic
1026287461 7:68975821-68975843 ATAGTTTAGCACCATATCCTTGG + Intergenic
1026300606 7:69094706-69094728 ATGGTTTAGCACCATCTCCTTGG - Intergenic
1026535322 7:71234151-71234173 GTGGTTTAGCACAACCAACCAGG + Intronic
1026600919 7:71776600-71776622 ATGGTTGAGGACCACTGCCTGGG + Intergenic
1026611650 7:71865223-71865245 ATGGTTTAACATTACCCCCTTGG + Intronic
1026612035 7:71868679-71868701 ATGCTTTAGCCCCATCTCCTTGG - Intronic
1027342157 7:77221127-77221149 ATGGTATAGCACTATCCCCTTGG - Intronic
1027498111 7:78913271-78913293 ATGTTTTAGCACAATCCCCTTGG + Intronic
1027556267 7:79668455-79668477 ATGGTTTAGCACCATTCCTTTGG - Intergenic
1027751626 7:82154969-82154991 ATGGTTCAGCACCATCTCCTTGG + Intronic
1027935790 7:84600283-84600305 ATGGTTTAACACCATCCTCTTGG + Intergenic
1028059820 7:86298296-86298318 TTGGGTTGGCACCTCCACCTGGG + Intergenic
1028309644 7:89315232-89315254 ATGGCTTAGAACCATCAACTTGG - Intronic
1028397927 7:90392757-90392779 ATGGCTTAGCACTATCCCCTTGG + Intronic
1028418773 7:90609452-90609474 ATGATTTAGAACCATCCCCTTGG + Intronic
1028746136 7:94328750-94328772 ATGGTTTAGCACCATCTGCTTGG - Intergenic
1029502284 7:100939370-100939392 ATGGTTTAACACCATCCCCTTGG - Intergenic
1029521084 7:101062958-101062980 ATGGCTCAGCACCATCCCCTTGG + Intergenic
1029582431 7:101446148-101446170 ATGGTCTAGCACCATCCCCTTGG - Intronic
1029898406 7:104011522-104011544 ATGGTTTACCACTATCCCCTTGG + Intergenic
1029917753 7:104229945-104229967 ATGGTTTAGCACCTTCTCCTTGG - Intergenic
1030086586 7:105820785-105820807 ATGGTTTAGCACCATCGCCTTGG + Intronic
1030127520 7:106168549-106168571 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1030222012 7:107107392-107107414 TTAGTTTAGCAACACCACTTGGG - Intronic
1030286495 7:107832266-107832288 ATGGCTTAGCACCATCCTCTTGG - Intergenic
1030496930 7:110311989-110312011 ATGGCTTAGCACCATCCCTTTGG + Intergenic
1030710858 7:112747453-112747475 ATGATTTAGCACCATCCCCTTGG + Intergenic
1030908314 7:115213789-115213811 ATGGTTTAGCATCATCCCCTTGG + Intergenic
1030913954 7:115289218-115289240 TTGGTTTAGCACCATCCTCTTGG - Intergenic
1030999453 7:116397960-116397982 ATGATTTAGCACCATCTCCTTGG + Intronic
1031164462 7:118212543-118212565 AAGGTTTAGCACCATCCTCTTGG + Intergenic
1031208318 7:118791401-118791423 ATGGTTTATCAGCACCAAATAGG + Intergenic
1031208359 7:118791816-118791838 ATGGTTTAGCACCATCGCCTTGG - Intergenic
1031474680 7:122207133-122207155 ATGGTTGAGTACCTCCACTTGGG + Intergenic
1031618124 7:123904900-123904922 GTGGTTTAGCACCATCCCTTTGG - Intergenic
1031760247 7:125705158-125705180 ATGACTTAGCACCAGCTCCTTGG + Intergenic
1031796130 7:126176158-126176180 ATGGTTTAGCACCACCCCTCTGG + Intergenic
1031878058 7:127164053-127164075 ACGGTTTAGCACCATCCCCTTGG + Intronic
1032282450 7:130515399-130515421 ATGGTTTAGCACCATCCCCTTGG - Intronic
1032510833 7:132471053-132471075 ATGGTTTAGTACCATCCGCTTGG + Intronic
1032531737 7:132626479-132626501 GTGGTTTAGCACCATCCCTTTGG + Intronic
1032743785 7:134765727-134765749 ATGGTTTAGCACCATCTTCTTGG + Intronic
1032743794 7:134765796-134765818 ATGGTTTAGCACCATCTTCTTGG + Intronic
1032891251 7:136197957-136197979 ATGGATTAGCACCATCCCCTTGG - Intergenic
1033313404 7:140278953-140278975 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1033931338 7:146526543-146526565 ATGGTTGAGCACCATCCCCTTGG - Intronic
1033953768 7:146817743-146817765 ATGGTTTAGCACCATCCTCTTGG - Intronic
1034076520 7:148236909-148236931 ACGGTTTAGCACCACCCTCTTGG - Intronic
1034206668 7:149322140-149322162 ATGGTTCAGCACCATCCCCTCGG - Intergenic
1034364829 7:150537023-150537045 AGGGTTTAGAACCATCTCCTTGG - Intergenic
1034419659 7:150982764-150982786 ATGTATTGGCACGACCACCTTGG + Intergenic
1034691988 7:153021449-153021471 ATGGTTTAGCCCCATCCCTTTGG - Intergenic
1034699514 7:153084043-153084065 ATGGTTTAGTACCATCCCCTTGG - Intergenic
1034708991 7:153173863-153173885 ATGGTTTAGCACCATCCTTTTGG + Intergenic
1034729001 7:153367068-153367090 ATGGTTTAGCACTATCCCCTTGG - Intergenic
1035050550 7:155996380-155996402 ATAGTTCAGCACCATCTCCTTGG + Intergenic
1035062146 7:156077312-156077334 AGGGTTAAGCACCATCCCCTTGG - Intergenic
1035085915 7:156257840-156257862 ATGATTTAGCACCATCTCTTTGG - Intergenic
1035433016 7:158836521-158836543 ATGCTTTTGCACCATCCCCTCGG + Intergenic
1035819488 8:2576889-2576911 ATGGTTTAGCACCATCCCTTTGG - Intergenic
1036617423 8:10399408-10399430 ATGGCTTAGCGCCATCTCCTTGG + Intronic
1036637034 8:10558278-10558300 ATGGTTAAGCACCATCACCTTGG - Intergenic
1036666204 8:10742275-10742297 ATGGTTTAGCACCATCCACTTGG - Intronic
1036717782 8:11142515-11142537 ATGGCTTAACACCATCTCCTTGG + Intronic
1036914547 8:12792841-12792863 ATGGATTAGCACCATCCCCTCGG - Intergenic
1036927698 8:12923194-12923216 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1036957829 8:13209641-13209663 ATGGTTTAGCACCATCCTCTTGG + Intronic
1037033916 8:14142748-14142770 ATGGTCTAGCACCATCCCCCAGG + Intronic
1037177734 8:15966846-15966868 ATGGTTTAGTGCCATCCCCTTGG - Intergenic
1037244949 8:16822883-16822905 ATGGTCTAGCACCATCCCTTTGG - Intergenic
1037294966 8:17390380-17390402 ATGGTTTAGCACCATCGCCTTGG - Intronic
1037411806 8:18605745-18605767 ATGGTTTAGCACTACCTCCTTGG + Intronic
1037697145 8:21233525-21233547 ATGGCTTAGCACCATCCCCTTGG + Intergenic
1037879688 8:22566593-22566615 ATGGGGTTGCACCCCCACCTAGG - Intronic
1038188229 8:25294933-25294955 ATGGTTTAACACCATCCCTTTGG - Intronic
1038214038 8:25545449-25545471 ATGATTTAGCACCAACCTCTTGG - Intergenic
1038465402 8:27757855-27757877 ATGGGTTAGCACCATCCCTTTGG + Intronic
1038509125 8:28114574-28114596 ATGGCTTACCACCATCTCCTTGG - Intronic
1038714626 8:29980866-29980888 ATGATTTAGCACCATCTTCTTGG - Intergenic
1038823707 8:30977715-30977737 ATGGTTTAGCACCATCCCTTTGG - Intergenic
1038988937 8:32844737-32844759 TTGGTTTAGCACCATCCCTTTGG + Intergenic
1039081729 8:33740244-33740266 GTGGCTTAGCACCATCTCCTTGG - Intergenic
1039168001 8:34708091-34708113 ATGGTTTAGCGCCATCCCCTTGG - Intergenic
1039313978 8:36351674-36351696 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1039739439 8:40368552-40368574 ATGATTTAACACCATCCCCTTGG + Intergenic
1039976715 8:42372691-42372713 ATGGCTCAGCACCATCCCCTTGG - Intergenic
1040003353 8:42597640-42597662 CTGGTTTTGCACCATCCCCTTGG - Intergenic
1040013279 8:42680043-42680065 ATGGTTTAGCACCTTCCCCTTGG + Intergenic
1040792946 8:51254648-51254670 ATGGCTTAGCACCATCCCCTGGG + Intergenic
1040863584 8:52025026-52025048 ATGGTTTAGTACCATCCACTTGG + Intergenic
1041223358 8:55673745-55673767 ATGGTTTAGGACCATCCCCTTGG - Intergenic
1041265591 8:56061093-56061115 ATGGTTTAGCACTATCCCCTTGG + Intergenic
1041270068 8:56103024-56103046 ATGATTTAGCACCATCCTCTCGG + Intergenic
1041760491 8:61361136-61361158 ATGGGTTAGCACCTTCCCCTTGG - Intronic
1041869511 8:62616944-62616966 ATGGTTTAGCACCATCACATTGG + Intronic
1041872563 8:62651752-62651774 ATGGTTTCACACCATCCCCTTGG + Intronic
1041907872 8:63053548-63053570 ATGGTTTAGCACCATCCCCTTGG - Intronic
1041919240 8:63164451-63164473 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1042037523 8:64551917-64551939 ATGGTTTAACACCACCCCCTCGG + Intergenic
1042072190 8:64948725-64948747 ATGATTTAGCACCATCCCTTTGG - Intergenic
1042129583 8:65574227-65574249 ATGGCTTAGCACCATCCCCTTGG + Intergenic
1042169599 8:65978845-65978867 ATGGGTTAGCACCATCCCCTTGG - Intergenic
1042769852 8:72367572-72367594 ATGGTTTAGCACCATCTCCCTGG + Intergenic
1042893989 8:73645886-73645908 ATGGTTTAGCACCATCCCCTTGG - Intronic
1043036782 8:75208870-75208892 ATGGTTTAACACCATCCCTTTGG - Intergenic
1043085671 8:75828112-75828134 ATGGTTTAGCACCATTCCCTTGG + Intergenic
1043159327 8:76826251-76826273 ATGGCTTAGCACCATTCCCTTGG - Intronic
1043192360 8:77241690-77241712 CTGGTTTAGCACCATCCGCTTGG + Intergenic
1043222546 8:77685678-77685700 CTGGTTTAGCACATCCCCCTTGG + Intergenic
1043615184 8:82116238-82116260 ATGGTTTAGAACCATCCCTTTGG + Intergenic
1043709215 8:83393775-83393797 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1043765159 8:84121712-84121734 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1043823955 8:84902355-84902377 ATGGTTTAGCACCATCCTCTTGG - Intronic
1044140424 8:88644620-88644642 ATGGTTTAGCACCACCCACCTGG - Intergenic
1044312276 8:90707921-90707943 GTGGTTTAGCACCATCCTCTTGG + Intronic
1044480965 8:92687552-92687574 ATGGTTTAGTGCCATCCCCTTGG + Intergenic
1044515788 8:93136876-93136898 ATGGTGTAGCACCATGCCCTTGG - Intronic
1044522572 8:93216412-93216434 AAGCTGTAGCCCCACCACCTCGG - Intergenic
1044536884 8:93367483-93367505 TTTGTTAAGCACCACCACTTTGG + Intergenic
1044619314 8:94173298-94173320 ATGGCTGAGCACCACGCCCTTGG + Intronic
1044673806 8:94709945-94709967 ATGATTTAGTACCATCCCCTTGG - Intergenic
1044684228 8:94811745-94811767 ATGGTTTAGCACCATCATCTTGG - Intergenic
1044894924 8:96881432-96881454 ATGATTTAGCACCATCCCCCTGG - Intronic
1045236112 8:100353864-100353886 ATGGTTTAGCACCTTCCCCTTGG - Intronic
1045601339 8:103721055-103721077 ATGGTTTAGCACCATCCCTTTGG + Intronic
1045996894 8:108373538-108373560 ATGGCTTAGCACCATCCCATGGG + Intronic
1046060526 8:109134256-109134278 ATGTTTCAGCACCTGCACCTGGG - Intergenic
1046066004 8:109197368-109197390 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1046084108 8:109410551-109410573 ATGGCTTAGCACCATCCCATCGG - Intronic
1046178038 8:110605203-110605225 ATGGTTTAGTACCATCCCGTTGG - Intergenic
1046266911 8:111842722-111842744 ATGGCTTAGCACTATCCCCTTGG + Intergenic
1046392496 8:113593874-113593896 ATTGATTAGCACTACTACCTGGG + Intergenic
1046450461 8:114383660-114383682 ATGGTTTGGCACCACCCCCTTGG + Intergenic
1046666645 8:117010893-117010915 ATGGTTTAGCACCATCCGCCTGG - Intronic
1046685346 8:117219843-117219865 ATGGCTTAGCACCATCCCCTTGG - Intergenic
1046804282 8:118463212-118463234 AGGTTCTAGCCCCACCACCTGGG - Intronic
1046888165 8:119392111-119392133 ATGGTTTAGCACCATCCCTTTGG - Intergenic
1047013626 8:120699371-120699393 ATGGCTTAGCGCCATCCCCTTGG + Intronic
1047041282 8:120998959-120998981 ATGGCTTAGCGCCATCCCCTTGG + Intergenic
1047051783 8:121120877-121120899 ATGGTTTAGCATCATCTGCTTGG - Intergenic
1047128897 8:121995860-121995882 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1047940360 8:129823032-129823054 ATGGTTTAGTTCCACGCCCTTGG + Intergenic
1048169520 8:132092496-132092518 ATGGGTTAGCACCACGTCCTTGG + Intronic
1048392089 8:133976707-133976729 ATGGTTTAACACCAGCGTCTTGG + Intergenic
1048569488 8:135639817-135639839 ATGGTTTAGCAACATCCCCTCGG - Intronic
1048611586 8:136028829-136028851 ATGGTTTAGCACTATCCCCTTGG - Intergenic
1048637198 8:136310029-136310051 ACAGTTTAGCACCACCTCCCTGG + Intergenic
1048849504 8:138630944-138630966 ATGGTTTAGCACAATCCCCTTGG + Intronic
1048922687 8:139245554-139245576 ATGGCTTAGCACCGTCCCCTCGG - Intergenic
1049457052 8:142698701-142698723 ATGGTTTAGCACTATCCCTTTGG - Intergenic
1049871625 8:144983296-144983318 ATGGCTTAGCACCATCCCCCTGG + Intergenic
1050175261 9:2863586-2863608 ATGGTTTAACGCCATCCCCTCGG + Intergenic
1050236519 9:3586955-3586977 ATGGCTTAGCACCATCCCTTTGG + Intergenic
1050284344 9:4085689-4085711 ATGGTTTAGCGCTATCCCCTCGG + Intronic
1050672810 9:8016872-8016894 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1051442255 9:17097987-17098009 ATGGTTTAGCACCATCCTTTTGG - Intergenic
1051510687 9:17874737-17874759 ATGGTTTAGCACCATCTCCTTGG - Intergenic
1052193276 9:25682639-25682661 ATGGCTTAGGACCATCCCCTTGG + Intergenic
1052530990 9:29683554-29683576 ATGGTTTAATACCATCCCCTTGG + Intergenic
1052549694 9:29932151-29932173 ATGGCTTAGCACCATCTCCCTGG - Intergenic
1052661294 9:31435559-31435581 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1053018332 9:34676896-34676918 AGGGCTTAGCCCCACCCCCTTGG - Intergenic
1053545960 9:39023142-39023164 ATGGTTTAGAACCATCCCCTTGG - Intergenic
1053610619 9:39709751-39709773 ATGGTTTGGCACCATTCCCTTGG - Intergenic
1053627472 9:39889642-39889664 ATGGTTTAGCACCATCTCCTTGG - Intergenic
1053778519 9:41576379-41576401 ATGGTTTAGCACCATCTCCTTGG + Intergenic
1053810279 9:41844814-41844836 ATGGTTTAGAACCATCCCCTTGG - Intergenic
1053868654 9:42467773-42467795 ATGGTTTGGCACCATTCCCTTGG - Intergenic
1054087634 9:60761406-60761428 ATGGTTTGGCACCATTCCCTTGG + Intergenic
1054166481 9:61786623-61786645 ATGGTTTAGCACCATCTCCTTGG + Intergenic
1054216415 9:62361061-62361083 ATGGTTTAGCACCATCTCCTTGG + Intergenic
1054242904 9:62632644-62632666 ATGGTTTGGCACCATTCCCTTGG + Intergenic
1054557028 9:66667162-66667184 ATGGTTTGGCACCATTCCCTTGG + Intergenic
1054620314 9:67342625-67342647 ATGGTTTAGAACCATCCCCTTGG + Intergenic
1054671066 9:67794282-67794304 ATGGTTTAGCACCATCTCCTTGG - Intergenic
1055031201 9:71772562-71772584 ATGGTTTAGTACCATCCTCTTGG + Intronic
1055102832 9:72482759-72482781 ATGGTTTAGCAACATCCCGTTGG + Intergenic
1055166114 9:73196093-73196115 ATGGTTTAGCACCATCCTGTTGG + Intergenic
1055191816 9:73533772-73533794 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1055453507 9:76452674-76452696 ATGGTTTAGCACCATCCCTTTGG - Intronic
1055561214 9:77523453-77523475 ATGGTTTAGCACCATCCGGTTGG - Intronic
1055561974 9:77530221-77530243 ATGGTTTAGCACCCTCACCTTGG + Intronic
1055856726 9:80697173-80697195 ATGGCTTAGCACCATCTCCTTGG - Intergenic
1055879851 9:80987661-80987683 ATGGATTAGCACCATTCCCTTGG + Intergenic
1055951795 9:81736154-81736176 ATGCTTTAGCACTATCCCCTCGG - Intergenic
1056109170 9:83377536-83377558 ATGGTTTAGCACCTTCCTCTTGG + Intronic
1056188823 9:84164903-84164925 ATGGTTTAGCACTATCCCCTCGG + Intergenic
1056192550 9:84198673-84198695 ATGGTTTAGCATCATCCCCTTGG - Intergenic
1056427602 9:86492691-86492713 ATGGTTTAACACCATCCTCTTGG + Intergenic
1056468227 9:86879701-86879723 ATGGTTTAGCACCATCCCGTTGG - Intergenic
1056525777 9:87441744-87441766 ATGGTTTAGCACCACCCTCTTGG - Intergenic
1056604258 9:88072957-88072979 ATGGGTTAGCACCATCCTCTTGG - Intergenic
1056694240 9:88832917-88832939 ATGGATTAGGACCATCGCCTTGG - Intergenic
1056912570 9:90716195-90716217 ATGGTTTAGAACCAGCCCTTTGG + Intergenic
1057319336 9:93997871-93997893 ATGGTTTAGCCCCATTCCCTTGG - Intergenic
1057340004 9:94191917-94191939 ATGGTTTAGCACCATCCCTTCGG - Intergenic
1057345909 9:94250550-94250572 ATGGCTTAGCTCCATCCCCTTGG - Intergenic
1057458038 9:95232211-95232233 ATGGTTTAGCACCATCCCCCTGG - Intronic
1057638586 9:96795568-96795590 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1057837964 9:98461939-98461961 ATGGTTTAGCACCATCCCTTTGG - Intronic
1058021007 9:100088664-100088686 ATGGAATAACACCACCACTTAGG + Intronic
1058046475 9:100363041-100363063 ATGGTTTAGCACAATCTCCTTGG + Intergenic
1058149369 9:101447104-101447126 ATAGCTTAGCACCACTTCCTTGG - Intergenic
1058182066 9:101810210-101810232 ATGGTTTAGCACCATCCCCTCGG + Intergenic
1058236919 9:102501825-102501847 CTGGTAAAGCATCACCACCTGGG + Intergenic
1058272647 9:102992552-102992574 ATAGTTTAGCACTATCCCCTTGG + Intergenic
1058388835 9:104471091-104471113 ATGATTTAGTACCATCTCCTTGG - Intergenic
1058498902 9:105591039-105591061 ATGGTTTAGCACCATCCTCTTGG - Intronic
1058581770 9:106466411-106466433 ACGGTTTAGCACCATCATCTTGG + Intergenic
1058652906 9:107193741-107193763 ATTGTTTAGCACTATCCCCTTGG + Intergenic
1058724389 9:107788051-107788073 GTGGTTTAGCACCATCTCCTTGG + Intergenic
1058927612 9:109682995-109683017 ATAGTTTAGCACCATGTCCTTGG + Intronic
1059065010 9:111074608-111074630 ATGATTTAGCACCATCCTCTTGG - Intergenic
1059444017 9:114327161-114327183 ATGGTTTAGCCCCACCTCCCAGG + Intergenic
1059445224 9:114333940-114333962 ATGGTTTAGCCCCACCTCCCAGG + Intergenic
1059612801 9:115917241-115917263 ATGGGTTAGCACCATTCCCTTGG - Intergenic
1059617432 9:115966633-115966655 ATGGATTAGCACCAACCCTTTGG - Intergenic
1059617713 9:115968660-115968682 ATCGGTTAGCACCACCCTCTTGG - Intergenic
1059698336 9:116749746-116749768 ATGGTTTAACACCATCCCGTTGG + Intronic
1059765367 9:117378888-117378910 ATGGTTTAGCACCATCCCCTTGG + Intronic
1059779981 9:117515972-117515994 ATGGTTTACCACCACCCCCCTGG - Intergenic
1059825289 9:118021462-118021484 ATGGTTTTGCACCACACCTTGGG + Intergenic
1059917144 9:119116706-119116728 ATGGCTTAGCACCATCCCTTTGG + Intergenic
1059917424 9:119118779-119118801 ATGGCTTAGCACCATCCTCTTGG + Intergenic
1060334283 9:122706707-122706729 ATGGTTTAGCACCATCTTCTTGG - Intergenic
1060502428 9:124171054-124171076 ATGGCTTAGCACTATCCCCTTGG - Intergenic
1060505553 9:124195483-124195505 ATGGCTTAGTACCATCCCCTTGG - Intergenic
1060592026 9:124823341-124823363 ATGGTTTAGTACCATACCCTTGG - Intergenic
1060785437 9:126448762-126448784 ATGGTTCAGCACCATCCCCTTGG - Intronic
1060890164 9:127183112-127183134 ATGGCTTAGCACCATCCCCCTGG - Intronic
1061618634 9:131796486-131796508 ATGGTTTAGCACTATCCGCTGGG - Intergenic
1061742967 9:132720871-132720893 AGGGTTTAGTACCATCTCCTTGG - Intergenic
1062148159 9:135002266-135002288 ATGGTTTAGCACCCTCCTCTTGG - Intergenic
1203708149 Un_KI270742v1:71018-71040 GTGGTTCAGCACCATCCCCTTGG + Intergenic
1203543229 Un_KI270743v1:108923-108945 GTGGTTCAGCACCATCCCCTTGG - Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185710941 X:2303361-2303383 ATGGGTTAGCGCCATCCCCTTGG + Intronic
1186003252 X:5038627-5038649 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1186151847 X:6683076-6683098 ACGGTTTAGCACCATCCTCTTGG - Intergenic
1186574356 X:10749821-10749843 ATGGTTTAGCACCATCTCTTTGG - Intronic
1186574629 X:10751880-10751902 ATGGCTTAGCACTATCCCCTTGG + Intronic
1186603017 X:11058611-11058633 ATGGTTTATCACCATCTTCTTGG - Intergenic
1186850640 X:13576343-13576365 ATGGTTTAGCACCATCCCCTTGG - Intronic
1187071431 X:15892558-15892580 ATCGTTTAGTACCATCCCCTTGG - Intergenic
1187114423 X:16334551-16334573 ATGGCTTAGCACCATCCCCTTGG - Intergenic
1187209014 X:17210535-17210557 ATGGTTTAGCCCCATCTCCTTGG - Intergenic
1187545743 X:20250453-20250475 ATGGTGTAGTCCCAGCACCTTGG - Intronic
1187561546 X:20408078-20408100 ATTGTTTAGCACCATCCTCTTGG - Intergenic
1187768323 X:22667684-22667706 ATGGTTTAGCACCATCCCTCTGG + Intergenic
1187851119 X:23592716-23592738 ATGGCTTAGCACCATCCCCTTGG - Intergenic
1187882664 X:23861228-23861250 ATGGTTTAACACCATTCCCTTGG + Intronic
1188009455 X:25041013-25041035 ATGGCTTAGCGCCATCCCCTTGG - Intergenic
1188045341 X:25419929-25419951 ATGGTTTAGCACCATACTCTTGG + Intergenic
1188090928 X:25964495-25964517 ATGGCTTAGCACCATCCCCTTGG + Intergenic
1188138192 X:26515397-26515419 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1188185402 X:27108400-27108422 ATAATTTAGCACCATCCCCTTGG + Intergenic
1188238126 X:27753775-27753797 ATGGTTTAGCGCCATCCCCTTGG - Intergenic
1188618733 X:32192996-32193018 ATGGTTTAACACCATCCTCTTGG + Intronic
1188775668 X:34215538-34215560 GTGGTTTAGCACCATCCCCTTGG + Intergenic
1188857807 X:35219100-35219122 ATGGCTTAGCACCATCTCCTTGG + Intergenic
1188911454 X:35852933-35852955 AAGGTGTAGCTCAACCACCTTGG + Intergenic
1188957183 X:36447741-36447763 ATGGTTTAGCACTATCCACTTGG - Intergenic
1189202771 X:39212040-39212062 ATGGTTTAGCATCATCCCTTTGG - Intergenic
1189263990 X:39699713-39699735 ATGGTTTAGCACCATCCCCTCGG - Intergenic
1189431556 X:40951718-40951740 ATGGTTTGGCACCATCCCTTTGG - Intergenic
1189973278 X:46439210-46439232 ATGGTTTAGCATCATCCTCTTGG + Intergenic
1190097571 X:47493934-47493956 ATGGCTTAGCACCATCCCCTTGG - Intergenic
1190145691 X:47889880-47889902 ATGGTTTAGCACCATCCCCTTGG - Intronic
1190512749 X:51191218-51191240 ATGGTTTAGTGCCATCCCCTTGG - Intergenic
1190558913 X:51668197-51668219 ATGGTGTAGCACCATCCCCTTGG + Intergenic
1190565378 X:51725125-51725147 ATGGTGTAGCACCATCCCCTTGG - Intergenic
1190576720 X:51846801-51846823 ATGGTTTAGCACCATCCACTTGG - Intronic
1190703437 X:53005535-53005557 ATGGTTTAGCAACATTCCCTTGG - Intergenic
1190704678 X:53017007-53017029 ATGGTTTAGCACCATCCCCGTGG + Intergenic
1190810313 X:53876955-53876977 ATAGTTGAGCACCATCCCCTTGG - Intergenic
1190958981 X:55226953-55226975 ATTGTTTAGCACCATCCCCTTGG + Intronic
1190959267 X:55229012-55229034 ATGGTTTAACACCATTCCCTTGG + Intronic
1191015242 X:55802645-55802667 TTGGTTTAACACCATCCCCTTGG + Intergenic
1191600740 X:63002438-63002460 ATGGTTTAGCACCATCCCCTTGG + Intergenic
1191724065 X:64260228-64260250 ATGGTTTAGCATCATCCACTTGG + Intergenic
1191769073 X:64735613-64735635 ATGGGTTAGCACCACCCCCTTGG - Intergenic
1191877851 X:65813933-65813955 ATGGTTTAACACCATCTCTTTGG + Intergenic
1192038884 X:67596007-67596029 ATGGCTCAGCACCATCCCCTTGG + Intronic
1192067463 X:67901809-67901831 ATGGTTTAGCACCATTTTCTTGG + Intergenic
1192295439 X:69842739-69842761 ATGGTTCAGCAGCATCCCCTTGG + Intronic
1192316772 X:70058467-70058489 GTGGTTTAGCACCATCCTCTTGG - Intergenic
1192388899 X:70704002-70704024 ATGGTTTAGCACCATCCCTTTGG + Intronic
1192479881 X:71475861-71475883 ATGGCTTAGCATCATCCCCTTGG + Intronic
1192501558 X:71657201-71657223 ATGGTTTAGCACCATCCACTTGG - Intergenic
1192508624 X:71708075-71708097 ATGGTTTAGCAGCATCCACTTGG - Intergenic
1192512022 X:71726627-71726649 ATGGTTTAGCAGCATCCACTTGG + Intergenic
1192514675 X:71754878-71754900 ATGGTTTAGCAGCATCCACTTGG - Intergenic
1192518073 X:71773478-71773500 ATGGTTTAGCAGCATCCACTTGG + Intergenic
1192527965 X:71863850-71863872 ATGGTTTAGCAGCATCCACTTGG - Intergenic
1192660807 X:73040446-73040468 ATGGTTTAGAACCATCCCTTTGG - Intergenic
1192706780 X:73534366-73534388 ATGGTTTAGCTCCATACCCTTGG + Intergenic
1192760583 X:74091557-74091579 ATGATTTAGCACCATTAGCTTGG - Intergenic
1192912898 X:75624083-75624105 GTGGTTTAGCACCATCACCTTGG - Intergenic
1192923071 X:75728514-75728536 ATGGTTTAGTACCATCCCCCAGG - Intergenic
1192936846 X:75869434-75869456 ATGGTTTAACACCATCCCCTTGG + Intergenic
1193026422 X:76850547-76850569 ATGGTTTAACACCACTCCCTGGG - Intergenic
1193121319 X:77825272-77825294 ATGGTTTAGTACCATCCCTTTGG + Intergenic
1193205099 X:78739009-78739031 ATGGTTTAGCACCATCCCATTGG - Intergenic
1193277910 X:79612008-79612030 ATGGTTTAGCACCATTCCTTTGG - Intergenic
1193402130 X:81057788-81057810 ATGGTTTAGCACGATCCCTTTGG - Intergenic
1193466285 X:81852053-81852075 ATGGTTTAGCACCACCCCCTTGG - Intergenic
1193466559 X:81854385-81854407 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1193518840 X:82504004-82504026 ATGGTTTATCATCATCACTTTGG + Intergenic
1193547168 X:82844845-82844867 ATGGTTTGGCACCATCTCCTTGG + Intergenic
1193638328 X:83980675-83980697 ATGTTTTAGCACCATCCCCTTGG + Intergenic
1193801754 X:85945347-85945369 ATGGTTTAGCATCATCCTCTTGG + Intronic
1193802025 X:85947342-85947364 ATGGTTTAGCACCATCACCTTGG + Intronic
1193911627 X:87313697-87313719 TTGGTTTAGCGCCATCCCCTTGG - Intergenic
1193964577 X:87969345-87969367 ATGGTTGAGCACCATCCTCTTGG + Intergenic
1194019397 X:88668349-88668371 ATGGTTTAGTGCCATCCCCTTGG - Intergenic
1194039148 X:88918253-88918275 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1194092623 X:89597947-89597969 AAGGTTTAGCACCACCCCCTTGG - Intergenic
1194119769 X:89947391-89947413 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1194129369 X:90061268-90061290 TGGGTTTAGCACCATCTCCTTGG + Intergenic
1194306673 X:92257221-92257243 ATGATTTAGCACCATCCTCTTGG - Intronic
1194417919 X:93636511-93636533 ATGGTTTAACACCATCACACTGG + Intergenic
1194419158 X:93650536-93650558 ATGGCTTAGCACCATTTCCTTGG + Intergenic
1194453339 X:94072164-94072186 ATGGTTTAGCACAACTCCCTTGG + Intergenic
1194473333 X:94325710-94325732 ATGGCTTAGCACTATCCCCTTGG - Intergenic
1194559058 X:95397604-95397626 ATGGTTTAACACCATCCCCTTGG + Intergenic
1194680220 X:96843110-96843132 ATGGTTTACCACCACCGCCCTGG + Intronic
1194927986 X:99850046-99850068 ATGGTTTAGGACTACCCTCTTGG + Intergenic
1194961682 X:100243473-100243495 ATGGTTTAGCACCATCCCCTTGG - Intergenic
1195122520 X:101769929-101769951 ATGGTTTAGCACTATCCTCTTGG + Intergenic
1195512418 X:105732372-105732394 ATGGCTTAGCACCATCCCTTTGG + Intronic
1195605083 X:106797306-106797328 ATGATTTAGCATCATCCCCTTGG - Intergenic
1195627486 X:107019111-107019133 ATGGTTTAACACCATCCCCCTGG + Intergenic
1195653862 X:107315505-107315527 ATGGTTTAGTACCATCCCTTTGG + Intergenic
1195717180 X:107828025-107828047 ATGGTTTAGCACCATCACCTTGG + Intronic
1196028906 X:111074312-111074334 ATGGCTTAGCACCAACCCTTTGG + Intronic
1196315214 X:114214057-114214079 ATGGTTTAGCACCCTCCCTTTGG - Intergenic
1196599220 X:117582950-117582972 ATGGGTTAGCACCATCCCCTTGG + Intergenic
1196934194 X:120713328-120713350 ATGGGTTAGCACCACCCCTTTGG + Intergenic
1196948538 X:120852450-120852472 ATGGCTTAGCACCATCTTCTTGG - Intergenic
1196970362 X:121101220-121101242 ATGCTTTAGCACCATCACCTTGG - Intergenic
1197006314 X:121504377-121504399 ATGGCTTAGTGCCATCACCTTGG - Intergenic
1197041948 X:121948020-121948042 ATGTTTTAGCACCATCATCTTGG - Intergenic
1197338085 X:125232693-125232715 ATGGCTTAGCACCATCCCCATGG - Intergenic
1197413984 X:126151507-126151529 ATGGATTAGCACCATCCTCTTGG - Intergenic
1197460446 X:126735124-126735146 ATGGTTTAGCATCATTCCCTTGG - Intergenic
1197473299 X:126890097-126890119 ATGGTTTAGCACCATCCTCTTGG - Intergenic
1197524642 X:127546599-127546621 ATGGTTTAGCACCATCCCTTTGG + Intergenic
1197524881 X:127548494-127548516 ATTGTTTAGCAACACCCCTTTGG + Intergenic
1197545938 X:127824165-127824187 ATGGTTTAGTGCCATCCCCTCGG + Intergenic
1197812223 X:130455431-130455453 TTGGTTTAGCACCATCCCTTTGG + Intergenic
1198093549 X:133355761-133355783 ATGGCTTAGCACCATCCCCCGGG + Intronic
1198144714 X:133843297-133843319 ATGGTTTAGCACCATCTCCTTGG + Intronic
1198187418 X:134267039-134267061 ACAGTTTAGCACCATCCCCTTGG - Intergenic
1198309613 X:135417701-135417723 GTGGTTTAGCACCATCCCCTTGG + Intergenic
1198456292 X:136821191-136821213 ATAGTTTAGTACCATCCCCTTGG - Intergenic
1198571886 X:137966093-137966115 ATGGTGTAGCACCATCCCCTTGG - Intergenic
1198709701 X:139487970-139487992 ATGGCTTAGCACCATCCCGTTGG - Intergenic
1198842449 X:140872604-140872626 ATGGTTCAGCACCACCCCCTTGG - Intergenic
1198852043 X:140975061-140975083 ATGGTTGAGCACCAACCACTCGG + Intergenic
1198951032 X:142072769-142072791 ATGGTTTACCACCATCCCCTTGG - Intergenic
1198979101 X:142374498-142374520 ATGGATTAACACCATCTCCTTGG + Intergenic
1198999362 X:142615912-142615934 ATGGTTTAGTACCATCTCCTTGG + Intergenic
1199006777 X:142708651-142708673 ATGACTTAGCACCACCCTCTTGG + Intergenic
1199148060 X:144395002-144395024 ATGGTTTAGCACCATTCCCATGG - Intergenic
1199188693 X:144945436-144945458 ATGGTTTAGCACCATCACCTCGG - Intergenic
1199257463 X:145733020-145733042 ATGGTTTGGCACCTTCCCCTGGG + Intergenic
1199289317 X:146088891-146088913 ATGGTTTAGCACCGTCCTCTTGG + Intergenic
1199383094 X:147193358-147193380 ATGGTCTAGCACCATCCCTTTGG + Intergenic
1199384443 X:147207613-147207635 ATGGTCTAGCACCATCCCTTTGG + Intergenic
1199948856 X:152689465-152689487 ATAGTTTAGTACCATCACCTTGG - Intergenic
1199960820 X:152778984-152779006 ATAGTTTAGTACCATCACCTTGG + Intergenic
1199963040 X:152794837-152794859 ATGGTTTAGCGCCACCCCCTTGG + Intergenic
1200009479 X:153110256-153110278 ATGGTTTAACACCATCCCCCTGG + Intergenic
1200030121 X:153289666-153289688 ATGGTTTAACACCATCCCCCTGG - Intergenic
1200050426 X:153426781-153426803 ATGGTTTAGTACCATCCTCTTGG + Intergenic
1200175025 X:154108324-154108346 ATGATTTAGCACCATCCTCTTGG - Intergenic
1200377363 X:155797407-155797429 ATGGTTTAGTACCATCCCCTTGG - Intergenic
1200445270 Y:3254050-3254072 AAGGTTTAGCACCACCCCCTTGG - Intergenic
1200472635 Y:3604923-3604945 ATGGTTTAGCACCATCCTCTTGG + Intergenic
1201320315 Y:12691318-12691340 ATGGTTCAGCACCATACCCTTGG - Intergenic
1201628222 Y:16039061-16039083 ATAGTTTAGCACCACTTCTTTGG - Intergenic
1202147254 Y:21811874-21811896 ATGGGTTAGTACCATCAGCTAGG - Intergenic