ID: 921934732

View in Genome Browser
Species Human (GRCh38)
Location 1:220786389-220786411
Sequence GCTCGCCGGCGCGGAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921934722_921934732 7 Left 921934722 1:220786359-220786381 CCAGGGGCCGCCGGGAGAACTCT 0: 1
1: 0
2: 1
3: 6
4: 83
Right 921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
921934724_921934732 0 Left 921934724 1:220786366-220786388 CCGCCGGGAGAACTCTGGCCTTG 0: 1
1: 0
2: 2
3: 15
4: 204
Right 921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
921934726_921934732 -3 Left 921934726 1:220786369-220786391 CCGGGAGAACTCTGGCCTTGGCT 0: 1
1: 0
2: 5
3: 36
4: 214
Right 921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
921934716_921934732 20 Left 921934716 1:220786346-220786368 CCCATTGCCGCTCCCAGGGGCCG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
921934720_921934732 13 Left 921934720 1:220786353-220786375 CCGCTCCCAGGGGCCGCCGGGAG 0: 1
1: 0
2: 3
3: 30
4: 284
Right 921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
921934717_921934732 19 Left 921934717 1:220786347-220786369 CCATTGCCGCTCCCAGGGGCCGC 0: 1
1: 0
2: 1
3: 14
4: 161
Right 921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
921934721_921934732 8 Left 921934721 1:220786358-220786380 CCCAGGGGCCGCCGGGAGAACTC 0: 1
1: 0
2: 2
3: 7
4: 75
Right 921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921934732 Original CRISPR GCTCGCCGGCGCGGAGGGCC TGG Intergenic
900161753 1:1227313-1227335 GCTCGCCTTCCCGCAGGGCCTGG - Intronic
900161788 1:1227429-1227451 GCTCGCCTTCCCGCAGGGCCTGG - Intronic
901050743 1:6424779-6424801 GCGCGGCGGAGCGGAGCGCCAGG + Exonic
901086418 1:6614423-6614445 GCAGGCCGGCGGGGAGGGGCTGG - Intronic
901453304 1:9349205-9349227 GCTCTCCGGCTCTGAGGGTCCGG + Intronic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
903287421 1:22285736-22285758 CCTGGGCGGCGCGCAGGGCCAGG + Intergenic
903468363 1:23568122-23568144 GGGCGCGGGCGGGGAGGGCCGGG - Intergenic
903597054 1:24502921-24502943 TCTCGCCGGCGTCGAGGGCGTGG + Exonic
905167026 1:36088786-36088808 GCTGGGCGGCGCTGTGGGCCTGG + Intergenic
905205334 1:36340106-36340128 GCTGTCCAGCGCTGAGGGCCAGG - Exonic
906197209 1:43936510-43936532 GCTCGTCGGAGCGGTGGCCCAGG - Exonic
906495736 1:46302885-46302907 GCTCGGGGGCGCGGGGGGCGAGG - Intronic
907011476 1:50968100-50968122 GCCCGACGGCGCGGTGGGCAGGG - Exonic
909393032 1:75136848-75136870 GCTGGCCCGCGAGGAGGGCAGGG + Intronic
910876823 1:91885948-91885970 GCTCGCCGCCGCCGAGCGCTGGG - Exonic
911725441 1:101237122-101237144 GGTCGCGGGCGCGGGGAGCCCGG + Intronic
914880165 1:151540674-151540696 GCTCGCCGGCGCCGAGTCCCAGG - Intronic
921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG + Intergenic
921934856 1:220786955-220786977 GCGCGCCAGCGCGGAGGAGCCGG - Exonic
922372964 1:224929759-224929781 GCTCGCCGGCGTGGGCGGGCCGG + Exonic
922518199 1:226223741-226223763 CCCCGCCGGCGTGGGGGGCCCGG - Exonic
922570904 1:226634229-226634251 GCTCTCCGGTGGGGAGGCCCCGG + Exonic
922739452 1:228007100-228007122 GCGAGAGGGCGCGGAGGGCCGGG - Exonic
1063662274 10:8043129-8043151 GGTCGTCGGCGCTCAGGGCCGGG + Intergenic
1063950379 10:11216686-11216708 GCTGGCCTGCGCGGAAGGGCCGG + Intronic
1067111890 10:43407303-43407325 GCTCGCGGGCGCTGGGGGCTCGG - Intronic
1072555899 10:96513550-96513572 GCTGGACGGCGAGGAGGGCACGG - Exonic
1073446613 10:103584774-103584796 GCGCGCCGGCGCGCAGGGCGTGG - Exonic
1076395888 10:130136904-130136926 GCTCCGTGGCGCGGAGGGCCGGG - Intronic
1077100321 11:819626-819648 GCTCGCTGGAGCCGGGGGCCGGG - Exonic
1082904593 11:58292311-58292333 GCTGGGCGGCGCTGTGGGCCTGG - Intergenic
1083900501 11:65641100-65641122 GCTGGCTGGCGTGGGGGGCCTGG - Exonic
1084010931 11:66347844-66347866 GCGCGCCGGCGGGGAGGGAGAGG - Intergenic
1085266797 11:75242143-75242165 GCCCGCGGGCGCGGCGGGCGCGG - Exonic
1085389023 11:76172731-76172753 GCTCACCGGAGTGCAGGGCCTGG + Intergenic
1091564697 12:1639745-1639767 GCTCGCCCTCGCGGCAGGCCCGG - Exonic
1096403250 12:51324279-51324301 GCAGGCCGGCTCGGAGGGGCGGG + Intronic
1096749247 12:53748280-53748302 GGGCGCTGGCGCGGAGGGCTTGG - Intergenic
1101970639 12:109309808-109309830 CCTCGCCGCCGCGCTGGGCCCGG - Intergenic
1102933961 12:116881651-116881673 GCTCCCCGCAGCGGAGGTCCTGG + Intergenic
1108648160 13:52450612-52450634 GCTCGCGGCCTCGGAGGGCCGGG - Exonic
1113416964 13:110136244-110136266 GCTCTCCAGGGTGGAGGGCCTGG - Intergenic
1113985771 13:114314591-114314613 GATGGACCGCGCGGAGGGCCCGG - Exonic
1115119960 14:29927514-29927536 GCTCGGCGGGGCGCAGGGCCGGG + Exonic
1122384619 14:101335451-101335473 GCTCGGCGGCGCGGAGGCAAAGG - Intergenic
1122666651 14:103334601-103334623 AGTCGCGGGCGCGGCGGGCCAGG + Intronic
1122775862 14:104116790-104116812 GCTCGGGCGCACGGAGGGCCCGG - Intergenic
1122905695 14:104800591-104800613 GCGCCCCGGCGGGGAGGGCGCGG - Intronic
1122981697 14:105195116-105195138 GCTCACGGGCACGGTGGGCCTGG - Intergenic
1123630743 15:22258206-22258228 GCGCGCGGGCGCCGCGGGCCGGG - Intergenic
1125956100 15:43792250-43792272 GCTCCCGGGCGCGAAGGGGCGGG + Intronic
1128075731 15:64824209-64824231 GCTCCGCGGTGCGCAGGGCCTGG + Exonic
1129387061 15:75202066-75202088 GCTCGCCCGCTCGGCGGGCGCGG + Intronic
1130255962 15:82326212-82326234 GCTCACCAGCAGGGAGGGCCAGG - Intergenic
1130598993 15:85263774-85263796 GCTCACCAGCAGGGAGGGCCAGG + Intergenic
1132641943 16:982027-982049 TCCCGCCGGCTCCGAGGGCCTGG + Exonic
1132828885 16:1918117-1918139 GCTGGACGGCTCGGAGGGCGCGG + Exonic
1132987802 16:2777160-2777182 GCTGGGCCGCGCGGGGGGCCCGG - Intronic
1134976204 16:18572803-18572825 GCTCACCTGCCCGGGGGGCCAGG - Intergenic
1135517684 16:23149223-23149245 GCTCGCCGCCGCCGGCGGCCCGG + Exonic
1137300663 16:47144478-47144500 ACTCACCGGCGCGAAGGGCACGG - Intergenic
1139466215 16:67155430-67155452 GCGCGCCGGCGCCGAGCGGCTGG - Exonic
1140504646 16:75463986-75464008 GAGCGCCTGCGCGGAGGGGCCGG + Intronic
1141682619 16:85553371-85553393 GGCCGCCGGCGCCGAGGGCCTGG + Intergenic
1141830607 16:86508296-86508318 GCTCGCCGGCGCAGCCTGCCGGG - Intergenic
1141959178 16:87392782-87392804 GCACCCCGCCGCGGAGGGCGCGG - Intronic
1141972302 16:87492367-87492389 GCGCGCGGGCGCCGCGGGCCGGG + Intergenic
1142230242 16:88896775-88896797 GCTGGCCGGGGCGGTGGGCAGGG - Intronic
1142590690 17:1004463-1004485 GCTCCCCAGCCCTGAGGGCCCGG + Exonic
1142709753 17:1716479-1716501 GGTCGCTGACGCGGAGGGCTGGG - Intergenic
1144527258 17:16000257-16000279 GCTCGGCCGGGCGCAGGGCCCGG - Intronic
1145059696 17:19724813-19724835 GCTCGCCGCCCCTGAGGGGCTGG - Intergenic
1146132560 17:30291726-30291748 GCCCGGCGGCGGGGAAGGCCGGG - Intronic
1148122645 17:45221957-45221979 GCTCAGCGGCGCGCAGGGGCCGG - Exonic
1150643552 17:66964858-66964880 GCGGGCGGGCGCGGCGGGCCGGG + Intergenic
1151612168 17:75183150-75183172 GCGCGCCCCCGCGGCGGGCCGGG - Intergenic
1152718451 17:81911102-81911124 GCTCGCCTGCCGGGAGGGTCGGG - Intronic
1152732478 17:81979118-81979140 GCTGGCGGGCGCAGTGGGCCAGG - Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1155096459 18:22560232-22560254 GCGCCCCGGAGCGGAGCGCCGGG - Intergenic
1157833617 18:50879199-50879221 GCTCGCAGAAGGGGAGGGCCGGG + Exonic
1159040561 18:63319994-63320016 GGCCGCCGGCAGGGAGGGCCCGG + Exonic
1159511261 18:69400841-69400863 GCTCCCCGGCGCGGGGGGAGGGG - Intergenic
1159920059 18:74219973-74219995 ACTGGCAGGCGCAGAGGGCCAGG - Intergenic
1160452448 18:78974523-78974545 GCTCGCCGGCGTGGAGGGGCCGG - Intergenic
1161076860 19:2290033-2290055 GCCGGCCGCCGCGGCGGGCCAGG - Exonic
1161394005 19:4035153-4035175 GCTCGGCGGGGCGGAGGGGCTGG + Intronic
1161513201 19:4683061-4683083 CCCCGCCGCCGCAGAGGGCCGGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161764551 19:6199534-6199556 GCGCGCAGGCGCGGACCGCCTGG - Intronic
1162021005 19:7868650-7868672 GCTGAGCGGCGCGGGGGGCCAGG - Intergenic
1165842621 19:38797964-38797986 GCTGGCCGGGGCGGCTGGCCGGG + Intergenic
1167133154 19:47600660-47600682 GCCCGCCCGCGCCGAGCGCCCGG - Intergenic
1167376299 19:49114213-49114235 ACTGGCCGGGGCGGAGGGCAGGG + Intergenic
1168316464 19:55486764-55486786 GCTGGCCTTCGCGGAGGCCCGGG + Exonic
1168336504 19:55600298-55600320 CCTCGCCGCCGCCGAGGGGCAGG + Intronic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
929795232 2:45053978-45054000 GCTGGCCAGCAAGGAGGGCCTGG - Intergenic
935592842 2:104856796-104856818 GATCTCCTGCGCGGAGGGCTTGG - Exonic
935820353 2:106887140-106887162 CCCCGCCAGCGCGGAAGGCCGGG + Intergenic
936104832 2:109614840-109614862 GCTCCCCGACGCGGCGGCCCCGG + Exonic
937183139 2:120013453-120013475 ACGGGCCGGGGCGGAGGGCCCGG + Intronic
944811252 2:203328903-203328925 GCTGACCGGCGCGGAGTGCGGGG - Intronic
948822874 2:240558717-240558739 GCTAGCCAGTGGGGAGGGCCAGG - Intronic
1168753144 20:297808-297830 GCTCGGCGGCCCCGCGGGCCTGG + Exonic
1168756773 20:324180-324202 GCTCCGCGGCGCGGGGGGCGGGG - Intergenic
1169006035 20:2207725-2207747 GCTCGCTGGCACGGAGCTCCCGG + Intergenic
1169131406 20:3168010-3168032 GCTCGCCGCCTCGGGGCGCCTGG - Intronic
1169168135 20:3441368-3441390 GCTGGCCGGGGCGGCTGGCCGGG + Intergenic
1171011672 20:21512578-21512600 GCTGCCAGGCGCGGAGGTCCAGG - Intronic
1172109419 20:32536535-32536557 GCGCCCCGGCGGGGAGGGGCGGG + Intronic
1172284739 20:33732403-33732425 GCTTGGCGGCGCGCGGGGCCCGG + Intronic
1173672914 20:44810418-44810440 GCTGGCGGGCGCGGCGGGGCCGG + Intergenic
1174467987 20:50731868-50731890 GCTGGGCGGAGCGGCGGGCCTGG + Intronic
1175108229 20:56629224-56629246 GGGGGCCGGCGCGGAGGCCCAGG - Intergenic
1176381588 21:6116616-6116638 GCTGGCAGGCACGGAGGGTCCGG + Exonic
1176381601 21:6116659-6116681 GCTGGCAGGCACGGAGGGTCTGG + Intronic
1176381613 21:6116702-6116724 GCTGGCAGGCACGGAGGGTCCGG + Intronic
1176381625 21:6116745-6116767 GCTGGCAGGCACGGAGGCCCCGG + Intronic
1176952625 21:15064814-15064836 GCTCGCCGGGGCGCCGGGCCAGG - Exonic
1179186313 21:39087611-39087633 GATGGCCGGCCCGGTGGGCCTGG - Intergenic
1179741847 21:43421494-43421516 GCTGGCAGGCACGGAGGCCCCGG - Intronic
1179741859 21:43421537-43421559 GCTGGCAGGCACGGAGGGTCCGG - Intronic
1179741871 21:43421580-43421602 GCTGGCAGGCACGGAGGGTCTGG - Intronic
1179741884 21:43421623-43421645 GCTGGCAGGCACGGAGGGTCCGG - Exonic
1179833547 21:44012838-44012860 GCGCGCCGGCGTCGAGGGCGAGG + Intronic
1180005817 21:45019984-45020006 GCTCGTGAGGGCGGAGGGCCAGG - Intergenic
1180871548 22:19149815-19149837 GCTCCCGGGCGCGGTCGGCCCGG - Exonic
1180875198 22:19171889-19171911 GGTCGCCTGCGCTGAGGGGCGGG - Intergenic
1181175503 22:21032580-21032602 GTTCGCCGGCGCCGAGCGCAGGG + Intronic
1182548712 22:31089986-31090008 GCTCCCCAGCACTGAGGGCCAGG + Exonic
1183149831 22:36028714-36028736 GCGGGGCGGCGCGGCGGGCCGGG - Intergenic
1183326843 22:37199034-37199056 TCCCGCCGGGGCAGAGGGCCTGG - Intronic
1183517132 22:38273037-38273059 GCTCGCCGCCGGGGAGGGCGGGG + Intergenic
949860647 3:8501742-8501764 GAGCGCCGGCGCGGAGTGGCTGG + Exonic
950729856 3:14947830-14947852 GGCCCCCGGCGCGGAGGGCAGGG - Intronic
954684589 3:52363513-52363535 GCTGGGAGGCTCGGAGGGCCTGG - Intronic
964887662 3:161503157-161503179 CCTGGCCTGCACGGAGGGCCTGG + Exonic
966874439 3:184314492-184314514 GCTCGGCGGCGCAGATCGCCCGG + Intronic
966905842 3:184525547-184525569 GCTCCCCGGGGCCGGGGGCCGGG + Intronic
968514244 4:1009753-1009775 GCGTGCCGGCGCGGGAGGCCCGG + Intergenic
968660021 4:1794997-1795019 GACCGCGGGCGCGGCGGGCCGGG + Intronic
969213974 4:5708577-5708599 GCTCGGCGGCGGGGCGGGCCTGG - Intronic
972484465 4:39528087-39528109 GGTTGCCGGCCCGGAGGGCGCGG - Intronic
975779144 4:77820274-77820296 ACTCCCCGGCGCGGAGGGTTGGG + Intergenic
984966364 4:185143509-185143531 GGGCGCGGGCGCGGCGGGCCGGG + Intronic
987050471 5:14143769-14143791 GCTGGCCGCCGCGGCGGGGCCGG - Exonic
990851570 5:60210971-60210993 GCTGGCGGGGGCGGAGAGCCTGG + Intronic
991245715 5:64506565-64506587 GCGCCCCGGCGCGGGCGGCCCGG - Exonic
992269950 5:75053601-75053623 GCGAGCCGCCGCGGAGAGCCTGG - Intergenic
999768154 5:154755997-154756019 GCTGCCCGGCGCCGAAGGCCCGG + Intronic
1001640732 5:173242473-173242495 GCTGGCCTGCGGGGAGCGCCCGG - Intergenic
1003645605 6:7910872-7910894 GCGCGCCGGCGCGGGCGGGCGGG - Intronic
1004492518 6:16129620-16129642 GGTCCCCAGCGCTGAGGGCCGGG + Intronic
1007927743 6:45663556-45663578 GCTCGCCGCAGCGGCGGGCCGGG - Intronic
1011643078 6:89433248-89433270 GCTGGGCGGCGCCGAGGCCCTGG + Intronic
1019492604 7:1322281-1322303 GCTCTCCGGGGAGAAGGGCCTGG - Intergenic
1019641147 7:2104341-2104363 GCTCTCCTTCGCGGAGGGGCGGG - Intronic
1019707013 7:2501780-2501802 GCTGGCAGGGGAGGAGGGCCGGG - Intergenic
1020140409 7:5608419-5608441 GCTCGCCGGGGCAGGGAGCCAGG + Intergenic
1021452766 7:20798037-20798059 GCTCGCCGGCCCGCAAGGCCCGG + Intergenic
1022230789 7:28410206-28410228 GCTCTCCAGCCCGGAGCGCCTGG - Intronic
1024043833 7:45574484-45574506 CCTCGCCGGCCCGGGGCGCCGGG - Intronic
1025916839 7:65873120-65873142 GCGCGCGGGCGCGGAGGGAGGGG - Intergenic
1028477253 7:91265534-91265556 GCTCGCCGGCGCCGTGCACCGGG - Exonic
1029238828 7:99144142-99144164 GCGCGGGGGCGCGCAGGGCCGGG - Intergenic
1033595332 7:142854924-142854946 GCGCGCCGGGGCGGAGGAGCGGG + Intergenic
1035233799 7:157483818-157483840 CCTCGCCTGCACGCAGGGCCGGG - Intergenic
1037819893 8:22130510-22130532 GCCCGCCGGCCGGGAGGCCCCGG - Exonic
1038883703 8:31640422-31640444 GCTCGCCGGCGCTGGGCACCGGG - Intronic
1040047091 8:42975188-42975210 GCCCGGCGGCGCTGAGGGCTTGG - Intronic
1040495398 8:47961021-47961043 GCGCGCCGGCGGGGAGGGCGTGG + Exonic
1041059396 8:54021926-54021948 GGACGCGGGCGCGGCGGGCCCGG + Intronic
1042040284 8:64581795-64581817 GCTCGTAGGCGCCGAGCGCCGGG - Exonic
1049532278 8:143160444-143160466 GCAAGGGGGCGCGGAGGGCCCGG - Intronic
1049761049 8:144332166-144332188 GCCCGCCGACGCCGGGGGCCTGG - Exonic
1049803199 8:144527561-144527583 GCGCGCCGGCTCGAAGGGCACGG + Exonic
1052542265 9:29826605-29826627 GCTCGCAGAAGGGGAGGGCCCGG - Intergenic
1052970182 9:34372586-34372608 GCGCGCCGGAGCGGAAGGCCAGG + Exonic
1053399005 9:37801055-37801077 GCTCTCCGGAGCGCGGGGCCGGG - Exonic
1058486517 9:105447804-105447826 GCCGGCCGGTGCGGAGGGCCCGG - Intronic
1062534177 9:137014357-137014379 GCTCCCTGGGGCGGAGGGCCCGG - Exonic
1185461096 X:333097-333119 GCTCCCCGGAGCTGAGGGCAGGG + Intergenic
1200098105 X:153673579-153673601 GCTCCGCGGCGCCGAGGGCTGGG - Intronic
1200239678 X:154486948-154486970 GCTCGCCCCCGCGGACTGCCTGG + Intergenic