ID: 921934854

View in Genome Browser
Species Human (GRCh38)
Location 1:220786950-220786972
Sequence CGCCGCCGGCTCCTCCGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 313}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921934841_921934854 29 Left 921934841 1:220786898-220786920 CCAGCGCGCTCCGGCCTTGCCGC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG 0: 1
1: 0
2: 4
3: 54
4: 313
921934842_921934854 19 Left 921934842 1:220786908-220786930 CCGGCCTTGCCGCCGCCACCTCG 0: 1
1: 0
2: 2
3: 25
4: 242
Right 921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG 0: 1
1: 0
2: 4
3: 54
4: 313
921934844_921934854 15 Left 921934844 1:220786912-220786934 CCTTGCCGCCGCCACCTCGCGGA 0: 1
1: 0
2: 0
3: 7
4: 152
Right 921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG 0: 1
1: 0
2: 4
3: 54
4: 313
921934845_921934854 10 Left 921934845 1:220786917-220786939 CCGCCGCCACCTCGCGGAGAAGC 0: 1
1: 0
2: 2
3: 5
4: 119
Right 921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG 0: 1
1: 0
2: 4
3: 54
4: 313
921934847_921934854 4 Left 921934847 1:220786923-220786945 CCACCTCGCGGAGAAGCCAGCCA 0: 1
1: 0
2: 1
3: 3
4: 184
Right 921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG 0: 1
1: 0
2: 4
3: 54
4: 313
921934846_921934854 7 Left 921934846 1:220786920-220786942 CCGCCACCTCGCGGAGAAGCCAG 0: 1
1: 0
2: 1
3: 7
4: 130
Right 921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG 0: 1
1: 0
2: 4
3: 54
4: 313
921934848_921934854 1 Left 921934848 1:220786926-220786948 CCTCGCGGAGAAGCCAGCCATGG 0: 1
1: 0
2: 1
3: 17
4: 124
Right 921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG 0: 1
1: 0
2: 4
3: 54
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921934854 Original CRISPR CGCCGCCGGCTCCTCCGCGC TGG Exonic
900077375 1:828045-828067 CGCCGGCAGCTGTTCCGCGCGGG + Intergenic
900185811 1:1332764-1332786 CGCCTCAGGCTGCCCCGCGCAGG + Exonic
900512971 1:3069047-3069069 CGCCGCCGCCGCCTCGGCGCGGG - Intergenic
901086414 1:6614418-6614440 CGCCCCCAGCCCCTCCCCGCCGG + Intronic
901109932 1:6785859-6785881 CGCCGGCTCCTCCTCCTCGCTGG - Intronic
902350130 1:15848021-15848043 CGCTGCTGGCTCCCCCTCGCCGG - Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903919257 1:26787943-26787965 CGCGGCCCGCGCCTGCGCGCTGG - Intronic
903998316 1:27322235-27322257 CGCCGCCGCCACCCCCGCCCAGG + Exonic
904199784 1:28812264-28812286 CGCCGCCGGCTGCCGCGCCCCGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904744464 1:32702621-32702643 CGGCGCCGTCCCCGCCGCGCCGG + Exonic
904769067 1:32870913-32870935 CGCCGCCACCGCCGCCGCGCGGG - Intronic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905463078 1:38134021-38134043 CTCCGCCTGCTCCGCCGCCCCGG - Intergenic
905518318 1:38578409-38578431 CGCCGCCGCCCCCTCCTCTCTGG - Intergenic
905819730 1:40980026-40980048 AGCTGCCGGCTCCCGCGCGCGGG + Intronic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
907069329 1:51519407-51519429 CGCGGCCGGCTCCGGCGGGCGGG - Intergenic
907296534 1:53459632-53459654 CGCCTCCTGCTCCTCCTCGGCGG - Exonic
908714290 1:67053761-67053783 CGCCGCCCGCTCCTCCTCCGCGG + Intronic
908796247 1:67833447-67833469 GGGCGCCGGCTCCGCCTCGCTGG + Exonic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
910449009 1:87328578-87328600 CGGCGCAGGCTCCAGCGCGCCGG + Exonic
912911058 1:113759413-113759435 TGCCGCCGCCTCCTCCTCCCGGG - Exonic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
913975387 1:143451089-143451111 CGTCCCCCGCGCCTCCGCGCTGG + Intergenic
914069778 1:144276705-144276727 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
914109377 1:144689649-144689671 CGCCCCCCGCGCCTCCGCGCTGG - Intergenic
914197337 1:145454429-145454451 CCCCGCCGGCCCCGCCGCCCCGG + Intergenic
916588303 1:166166614-166166636 CGCTGCCGCCTCCTCCTCTCCGG - Exonic
917962270 1:180154725-180154747 CGCCGGCCGCTCCTGGGCGCGGG - Intergenic
919892107 1:201982959-201982981 CGCAGGCGGCTCCTCCGAGCCGG - Exonic
921930191 1:220748537-220748559 CGCTTCCAGCTCCTCCGCGCTGG + Exonic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
922766162 1:228157687-228157709 CGCCGCGGGCTCCTAAGTGCAGG + Intronic
922937248 1:229432228-229432250 CGCCGCCGGCCCTCCCGCCCGGG + Intronic
923042989 1:230333088-230333110 TGCCGGCGGCTCCTCCGCCCTGG + Intronic
923171434 1:231421436-231421458 GGCCGGCGGCTCCTCCTTGCCGG + Exonic
924230478 1:241958227-241958249 CGCCGCCGCCTCGTCCTCGCTGG - Intergenic
1063593008 10:7410380-7410402 CTCCCGCGTCTCCTCCGCGCTGG - Intronic
1063995057 10:11611400-11611422 CGCCGCCGGCCCCTCACGGCGGG + Intronic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1066022772 10:31319582-31319604 CGCCGCCGCATCCCCGGCGCAGG + Intronic
1066080781 10:31928783-31928805 CGCGGCCGGCCCGTCCCCGCAGG + Exonic
1066464868 10:35642230-35642252 AGCCGCCGCCTCCTCCTCGGCGG + Exonic
1068554909 10:58448297-58448319 CGCCCCCTGCTCCGCAGCGCCGG - Intergenic
1069698356 10:70404351-70404373 CGCCGCCGCCGCCTGCCCGCCGG + Intergenic
1070290667 10:75111520-75111542 GGCCGCCGTCACCGCCGCGCCGG - Intronic
1072562232 10:96586897-96586919 CGCCGCCGCCGCCTCCGCCGCGG + Exonic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1074503360 10:114045014-114045036 CGCCGCCGCCACCGCCCCGCTGG + Exonic
1074722015 10:116272200-116272222 CGCCGCCGGCGACTCAGCTCCGG + Exonic
1075629316 10:123991683-123991705 CGCCGCCGCCGCCACCGCCCCGG - Intergenic
1075645440 10:124093259-124093281 CGCCACCGCCACCACCGCGCCGG + Intronic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1076373074 10:129967284-129967306 CGCCGCCGCCTCCTCCTCGGAGG + Intergenic
1077124360 11:925914-925936 CCCCGGCGGCTCCTCCGCGGCGG + Exonic
1077134903 11:993671-993693 CGCCGCCGTCCCCCCCCCGCGGG + Intronic
1078561675 11:12377886-12377908 CGCCGCGCGCCCCACCGCGCCGG - Intronic
1078631890 11:13010508-13010530 CGCCGCCGCCTGCGCCTCGCCGG - Intergenic
1082843925 11:57712066-57712088 CGCCACCGCCTCCTGCGGGCGGG - Exonic
1083048280 11:59755483-59755505 CGCCTCCAGCTCCTTCGCCCCGG + Exonic
1083599561 11:63938635-63938657 TGCCGCCGGCTGCTACGCGCGGG + Intergenic
1083997120 11:66278162-66278184 CGCCCCCGGCTCCGCCCCGCCGG + Intergenic
1084072382 11:66744804-66744826 CGCCGCCCCCTCCTCAGCCCGGG - Intronic
1085043965 11:73342928-73342950 CGCTGCTGCCTCCTCCGCGCTGG - Intronic
1085332919 11:75668079-75668101 CGCCGCCGGCTCGCGCTCGCCGG + Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085561272 11:77474211-77474233 CGCAGCCGCCGCCGCCGCGCCGG - Intronic
1089242953 11:117097901-117097923 CGCGCCCGGCTCCTGGGCGCCGG + Intronic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090284708 11:125489703-125489725 CTCCTCCGGGTCCTCCGAGCAGG + Exonic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1093547794 12:20368874-20368896 CGTCAGCGGCTCCTGCGCGCGGG + Intergenic
1094653429 12:32399389-32399411 CGCCGCCGCCTCCTCCGGCCGGG - Intergenic
1095261597 12:40105313-40105335 CACCGCCGGCTCCGCGGTGCTGG - Exonic
1096241326 12:49961795-49961817 CGCCCCCTGCCCCCCCGCGCCGG + Intergenic
1096695318 12:53344989-53345011 CGCCGCCCCCTCCCCCGGGCTGG - Intronic
1096716157 12:53492883-53492905 CGGCCCCGGCTCCTCCCCGAGGG - Intronic
1098255487 12:68611247-68611269 CGGCGGCTGCTCCTCCTCGCCGG - Intronic
1098416877 12:70243852-70243874 CGGCAGCGGCTCCTCCGCGCTGG - Intronic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1102278356 12:111599393-111599415 CCCCGCCCGCTCCGCCGCGCCGG + Exonic
1102854063 12:116277844-116277866 CGCGGCCGGGTCCTCCGGCCGGG + Intergenic
1103377718 12:120469649-120469671 CGCCGCCGCCGCCTCAGCACGGG + Exonic
1103779525 12:123389451-123389473 CGCCGCCGCCTCCACCGCGCGGG - Exonic
1105217511 13:18297711-18297733 CGCCGCCGCCTCCACCGCGCAGG - Intergenic
1106568508 13:30906688-30906710 CGCCGCCGGCTCCCCGGGCCTGG - Exonic
1107468094 13:40666935-40666957 TGTCGCCGGCGCCTCCACGCTGG - Intergenic
1109364685 13:61339497-61339519 CGCCCCCTGCTCCACTGCGCCGG + Intergenic
1110596592 13:77326794-77326816 CGCCGCCGCCTCGTCCCCGCGGG + Intronic
1113231677 13:108218733-108218755 AGCCGCCGGCTCCTCCAGGCGGG + Intronic
1113656040 13:112068236-112068258 CGCCGCCGCCGCCACCGAGCCGG - Exonic
1114485170 14:23057655-23057677 CGCCCCCGCCCCCGCCGCGCGGG - Intergenic
1115399317 14:32939415-32939437 CGCCGCCGCCTCCGCCGCCGAGG + Intronic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1117602784 14:57391409-57391431 CGCCGCTGCCTCCACCGGGCTGG - Exonic
1119286380 14:73458339-73458361 CGCCCCCGCCGCCTCCGCCCTGG + Intronic
1119438405 14:74612400-74612422 CGCCGCCCCCTGCTCCGCACGGG - Intergenic
1120953525 14:90062307-90062329 CGCCGCCGTCTTCTCCGCGCTGG + Exonic
1122145084 14:99684194-99684216 CGCCTCCGGCTCCGGCGCTCCGG - Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122558313 14:102593030-102593052 CGCCGCCGCCTCCTCAGCCTCGG + Exonic
1122658471 14:103278993-103279015 CGCGACCGCCTCCTCCGCCCCGG + Intergenic
1123040210 14:105487320-105487342 CGTCGGCGGCGCCTCCTCGCGGG - Intronic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124971146 15:34490544-34490566 CGCCGCCGCCGCCTCCGTGCTGG + Intergenic
1125155402 15:36579647-36579669 CTCCACCGGCACCTCCGCGGCGG - Exonic
1126767051 15:52019603-52019625 CGCCGCCCGCCCGCCCGCGCGGG - Intronic
1127415031 15:58749551-58749573 CGCCGCCGCCGCCTCCTCACGGG + Exonic
1128866073 15:71115838-71115860 CGCCGCGGGCTGCGCCGCTCCGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1129780119 15:78264537-78264559 AGCCACCGGCTCCTCCGCGGCGG - Intronic
1130076676 15:80695579-80695601 CGGCGCCGGCGCGTCCGCCCCGG + Exonic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1132055627 15:98648833-98648855 CGCCGCCGCCTGCTCTGCGCGGG - Intergenic
1132055650 15:98648875-98648897 CGCCGCCGCCCGCCCCGCGCCGG - Intergenic
1132398312 15:101489806-101489828 CGCGGCCGCCTCCTCCTCCCCGG - Exonic
1132497844 16:272260-272282 CGCGTCCGCCTCCTCCGCTCTGG - Intronic
1132580082 16:680694-680716 CGCCGCCGCCCTCCCCGCGCGGG - Intronic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1132828936 16:1918284-1918306 CGCCCCCGGCCCCGCCGCCCAGG + Exonic
1132873254 16:2124803-2124825 CGCAGGCGGCCCCTCCGAGCCGG - Intronic
1132954752 16:2585664-2585686 CGCTGCCGGCCCCTCCACGCCGG - Intronic
1133040880 16:3059244-3059266 CGCCGCCGCCGCCCCTGCGCGGG - Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133791614 16:9013408-9013430 TGCCGCCGCCTCCTCCTCCCGGG - Intergenic
1134034600 16:11020236-11020258 GGCCGCCAGCACCTCCGTGCAGG + Exonic
1135158475 16:20073677-20073699 CGCCGCCGCCACCACCGAGCCGG - Exonic
1135296537 16:21283933-21283955 CGCCGCCGCCTCCGCCGCTGCGG - Intronic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136458475 16:30395547-30395569 CGCCTCCGGCTCCGCCACCCCGG - Exonic
1136585334 16:31180694-31180716 CGCCGCCGAGTCTTCCGCGAAGG - Intronic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1139390801 16:66605363-66605385 CCCCGCCGGCTCGGCCCCGCAGG - Intronic
1141553206 16:84819859-84819881 CGCCCCCGGCCCCGCCCCGCAGG - Intergenic
1141972431 16:87492712-87492734 CGCCGCCCGCGCCTCCGCCCAGG + Intergenic
1142175544 16:88643419-88643441 CACCGCAGCCTCCTCCTCGCTGG + Exonic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1142871617 17:2824817-2824839 CGCCGCCTCCTCCTCCTCTCTGG - Intronic
1143099817 17:4498917-4498939 CCCCGTCGGCTCCTGCGCTCCGG - Exonic
1144758578 17:17694653-17694675 CGCCGGAGCCTCCTCCGCGGTGG + Intronic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147740793 17:42670097-42670119 TGCGGCCGGCCCCGCCGCGCCGG + Exonic
1147970973 17:44219078-44219100 CCCCGCCGGCGCCCCCGCCCCGG + Intronic
1148035448 17:44656487-44656509 CGCAGCCGCCTCCGCCGCCCGGG - Exonic
1148146885 17:45371710-45371732 AGCAGCCGGCTCGCCCGCGCAGG + Intergenic
1148432022 17:47650226-47650248 CGCCGCCGCCACCTCCGCCATGG + Exonic
1148664098 17:49361919-49361941 CGCCTCCGCCTCCGCCGCCCCGG + Intronic
1149314017 17:55421940-55421962 CCTCCCCGGCTCCTCCGCCCCGG + Exonic
1152356485 17:79810097-79810119 CGCCGCGGCCCCCTCCCCGCCGG + Intergenic
1152426432 17:80220792-80220814 CGCCCCCGGCCGCTCCGCTCCGG - Intronic
1152433101 17:80260503-80260525 CGCCGCCGCCGGCCCCGCGCAGG - Intergenic
1152699722 17:81812956-81812978 GCCCGCCGGCTCCCCCGCCCGGG + Intronic
1152831258 17:82498117-82498139 CGCCTCGGCCTCCTACGCGCTGG + Intergenic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1156171646 18:34493638-34493660 CGCGGCGGGCTCCTCTGCACCGG - Intronic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1157386143 18:47261170-47261192 CGGCGGCGGCTGATCCGCGCAGG - Intergenic
1157492765 18:48136053-48136075 CGACGCTGGATGCTCCGCGCGGG + Intronic
1158954123 18:62523477-62523499 CGCCTCGGGCTCCTCCGCCTCGG - Exonic
1159743999 18:72209415-72209437 CGCCGTGGGCTCCTGCGCGCGGG + Intergenic
1160745504 19:709254-709276 CGCCGCCTCCTGCTCCTCGCGGG - Intronic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1160873114 19:1285931-1285953 CGCGGCCGGGTCCTGCGCCCGGG + Intergenic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160991798 19:1863218-1863240 CGGCTCCGGGTCCGCCGCGCAGG + Exonic
1161001387 19:1912833-1912855 CCCCGCCTGCTCCTTCGCCCCGG + Exonic
1161400673 19:4065397-4065419 CCCCGCCGCCTCGCCCGCGCGGG + Intronic
1161585188 19:5101980-5102002 GGCCGCCTGCCCCTCCTCGCTGG - Intronic
1161628621 19:5340313-5340335 CGCCGCCGGCTGCACCACCCCGG - Intronic
1162312118 19:9913851-9913873 CCCCTCCCGCGCCTCCGCGCCGG + Intronic
1162935331 19:13978999-13979021 CGCCGCCGGAGCCGCCGCCCCGG - Intronic
1162987147 19:14277935-14277957 CGCCCCCTGCTCCGCGGCGCCGG + Intergenic
1163158137 19:15449914-15449936 CGCCGCCGCCTCCACCGCTCGGG + Exonic
1163665840 19:18603863-18603885 CGCCCCCGCCTCCTCGGCTCTGG - Intronic
1164594657 19:29525459-29525481 CGCCGCAGGCACCTGCTCGCTGG + Intergenic
1165850875 19:38849741-38849763 CACCGCCGCCGCCTCCGTGCTGG + Exonic
1166536077 19:43575597-43575619 CGACGCCGGCGCCGGCGCGCCGG - Exonic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1167609596 19:50500812-50500834 CGCCCCCAGCTCCTCCTCCCGGG + Intergenic
1167638362 19:50667706-50667728 CCCCGCCGGACCCTGCGCGCCGG - Exonic
925218748 2:2121004-2121026 GGGCGCTGGTTCCTCCGCGCCGG - Intronic
926101413 2:10120665-10120687 CGCCGCCACCTCCTCCGCAGCGG + Intergenic
927652481 2:24920595-24920617 CGCCGCCCCCTCCTCCGCCGCGG + Intergenic
933684614 2:85133427-85133449 CGCCGCCGCCTGCTCCGCCGGGG - Exonic
934180088 2:89612062-89612084 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934290379 2:91686322-91686344 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
934296795 2:91748939-91748961 CGCCGCCGCCTCCAGCGCGCGGG + Intergenic
934566843 2:95346222-95346244 CCCCGCCGCCGACTCCGCGCGGG + Intronic
938796042 2:134718921-134718943 CGCGGCCGGCTCCATGGCGCGGG + Exonic
939612998 2:144332478-144332500 CGTCGCCGGCTGGGCCGCGCCGG - Intronic
939898964 2:147827188-147827210 CGCCCCCTGCTCCACGGCGCCGG + Intergenic
941819177 2:169827713-169827735 CGCCGCCGCGTCCTCGCCGCCGG - Exonic
942965955 2:181892245-181892267 CGCTGCCGGCAGCTGCGCGCCGG - Exonic
943004975 2:182377919-182377941 CACTGCAGGCTCCTCCCCGCAGG + Intronic
943645819 2:190407788-190407810 CCCCGCCGGCTCCTCCCTCCCGG + Intergenic
944273138 2:197805116-197805138 CGGCGCCGGATCCTCCCTGCCGG - Exonic
944412671 2:199458591-199458613 TGTCGCCGCCGCCTCCGCGCCGG - Intronic
944515705 2:200509953-200509975 CGCGCCCGGCTCTTCCGCACCGG + Exonic
1168753215 20:298032-298054 CGCCGCCGGCTCATCCTGGAGGG - Exonic
1168828860 20:833549-833571 CTCCGCCCGCTCCTCCCAGCCGG - Intergenic
1169800338 20:9507089-9507111 CGCCGCCGCCTCCGCCGCCTGGG + Intergenic
1171173558 20:23035301-23035323 CGCCGCGCGCCCCACCGCGCGGG - Intergenic
1172036976 20:32018107-32018129 CGCCGCCGCCTCCTACCTGCAGG + Exonic
1172037308 20:32019118-32019140 CGCCGCCGCCTCCCCCGGCCCGG - Exonic
1172587014 20:36092382-36092404 CGCCGCCGGCTTCCCCACGTGGG - Intronic
1172841033 20:37903007-37903029 CTCCGCCGCCTGCTCCGAGCGGG + Intergenic
1173584952 20:44175561-44175583 TGCCGCCAGCTCCTCCGCTTCGG - Intronic
1173831227 20:46089862-46089884 CGCCGCTGCCGCCTCCGCGTCGG + Exonic
1174092348 20:48059172-48059194 CACCCCCGGCTCCACGGCGCTGG + Intergenic
1174330408 20:49812964-49812986 CCCCGCCGCCTCCGCCGCCCGGG - Intronic
1174494729 20:50931307-50931329 CGCCGCCGCCTCCGCCGGCCCGG - Intergenic
1174804585 20:53594165-53594187 CGCCCCCTACTCGTCCGCGCGGG + Intronic
1174870201 20:54174303-54174325 CGCTGCCGGCTCCTGCCCGCCGG - Intergenic
1175108228 20:56629219-56629241 CGGCGCCTGGGCCTCCGCGCCGG + Intergenic
1175581242 20:60101691-60101713 CACCGCCGGCTCCTACAAGCAGG + Intergenic
1175847213 20:62065312-62065334 GCCCGCCGGCCCCGCCGCGCTGG - Exonic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176201343 20:63862119-63862141 CGAGGCCGGCTACTCCGTGCTGG + Exonic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1179882639 21:44299979-44300001 CGCCCCCGGCGCCTCCTCGCAGG - Intergenic
1181169833 22:21001872-21001894 CGCCGCCGGCTGCTGCACACGGG - Exonic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1182051828 22:27318152-27318174 CGCCTCCTGCTTCTCCTCGCTGG - Intergenic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185055137 22:48575478-48575500 CGGCGCCGGCTCCTCGGGGGAGG - Intronic
1185281598 22:49972170-49972192 CGCCGCAGACCCCTCCCCGCAGG - Intergenic
1185349576 22:50327394-50327416 CGCCGCTGGCCCCTGCGCGGTGG - Intergenic
1185398647 22:50604930-50604952 CGCGCCCGCCTCCTCCTCGCTGG - Exonic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
953099279 3:39809532-39809554 CTCCGCAGGCTCCCCCGCTCCGG + Intronic
954437441 3:50503532-50503554 CGCCGCCGCCTTCTCCGCGAGGG + Intronic
955911560 3:63863888-63863910 CGCCGCCGCCTCCTCCTCCATGG - Exonic
956979025 3:74614800-74614822 CGCCCCCAGCGCCTCTGCGCCGG + Intergenic
958638546 3:96776894-96776916 CGCCGCCGGCTCCACCCACCCGG + Intergenic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961007198 3:123413064-123413086 TGACGCCGGCTCCTCCGGGACGG + Intronic
961202578 3:125056163-125056185 CGCCTCCGGGCCCGCCGCGCGGG - Intergenic
961827177 3:129605301-129605323 CGCCGCCGCCGCCACCGCCCGGG + Intronic
961858248 3:129893663-129893685 CGCCGCCGCCGCCTCAGCCCCGG + Intergenic
962820577 3:139044471-139044493 CCCCGCCGGGTCTTCCGGGCTGG + Exonic
963906679 3:150779014-150779036 CGTGGGCGGCTCCTCCGCGCAGG + Intergenic
966108161 3:176362256-176362278 CGCCCCCTGCTCCGCGGCGCCGG - Intergenic
968293490 3:197556033-197556055 CCGAGCCGCCTCCTCCGCGCTGG + Intronic
968382316 4:107536-107558 CTCCGCCCGCCCCTCCGCGCTGG + Intergenic
968462751 4:733435-733457 AGCCCCCGGCTCCCCCGCACTGG - Intronic
968636655 4:1684401-1684423 AGCCGCCGCCTTCTCCACGCCGG + Intergenic
969715944 4:8868197-8868219 CTCCGACGCCTCCTCCGTGCCGG + Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
975883578 4:78939294-78939316 CGCCGCTGGCGCCCCCGCCCCGG + Exonic
976053151 4:81031543-81031565 CGCCCTCGGCTCCTGCGCGAAGG + Exonic
978754238 4:112285740-112285762 CGGCCGCTGCTCCTCCGCGCGGG + Exonic
981366669 4:143912154-143912176 CGCCGCCGCCTCCTTCCCTCCGG + Intergenic
982033697 4:151325468-151325490 CGCCGCCGACGCCTCCTCTCCGG - Intronic
986402790 5:7396049-7396071 CGCCGCCACCGCCACCGCGCGGG - Intergenic
986813630 5:11385047-11385069 CGCTGCCCGCGCCGCCGCGCGGG - Exonic
988547792 5:32174285-32174307 CGCCGCCGCCGCCTCCGCCTTGG - Exonic
988595300 5:32585521-32585543 AGACGCCGGCCCCGCCGCGCTGG - Exonic
989569168 5:42929247-42929269 CGCCTCAGCCTCCTCAGCGCTGG + Intergenic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992042449 5:72848746-72848768 GGCCCCCGCCTCCTGCGCGCCGG - Intronic
992067457 5:73120711-73120733 CGCCGCCGGCGCAGGCGCGCGGG - Intronic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
992364876 5:76081869-76081891 CTCCACCGGCTCCTCTGGGCAGG + Intergenic
992529175 5:77638850-77638872 CGCCGCCGCCTCCTTCAGGCGGG - Exonic
997470643 5:134115168-134115190 CGGCGCCGGCTCCTCCCCCGCGG + Intronic
1000060553 5:157651787-157651809 AGCCGCTGCCTCGTCCGCGCAGG - Exonic
1001381419 5:171308929-171308951 CGCTCCCCGCTCCTCCGGGCCGG - Intergenic
1001470206 5:172006551-172006573 CGCCGTCGCCTCCTCCGCCCGGG - Exonic
1001639130 5:173232893-173232915 CGCCGCCGCCGCCTGCCCGCAGG - Exonic
1001640232 5:173238811-173238833 CTCCGCCTCCGCCTCCGCGCTGG + Intergenic
1001826695 5:174751211-174751233 CCGAGCCGGCTCCTCCGCCCCGG - Intergenic
1001928740 5:175658160-175658182 CGCGGCCGCCGCCTCCCCGCGGG + Intronic
1002159650 5:177307690-177307712 CACCTCCAGCTCCTCTGCGCGGG + Exonic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1002901849 6:1416395-1416417 CGCCCCCGTGTCCTCCGTGCTGG - Intergenic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1005040277 6:21594966-21594988 GGCCGCCGCCTCCTCCAAGCCGG + Exonic
1005940317 6:30555720-30555742 CGTCACCGGCCCCTCCCCGCAGG - Exonic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1006950803 6:37819865-37819887 CGCCACCGCCTCCTCAGAGCGGG + Exonic
1010703479 6:79078424-79078446 CCCCACCCGCTCCTCCCCGCAGG + Intergenic
1013793701 6:113860467-113860489 GGCCGCGGGCTCCTCCGCGGGGG - Exonic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017174947 6:151494070-151494092 CGCCGCCGCTTCCTCAGGGCCGG + Exonic
1017891581 6:158644194-158644216 CGCCGCCAGCCCCTCCGCCCCGG - Intronic
1017957004 6:159187059-159187081 TGCCGCTGGCTCCTCTGCTCAGG + Intronic
1018612779 6:165661200-165661222 CGCCGCCGCCTCCGACTCGCAGG - Intronic
1018686409 6:166307770-166307792 CGCCGCGGGCACCTCCTCGGGGG - Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019235885 6:170612304-170612326 CGCCGGCAGCTGTTCCGCGCGGG - Intergenic
1020074389 7:5248302-5248324 GGCCCCCGGCTCCTCCTCCCGGG - Intergenic
1020163964 7:5793823-5793845 CGTCCCCTGCTCCTCGGCGCCGG + Intergenic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1024499820 7:50093151-50093173 CGCCGCCTGCCCCGCCGCGCTGG + Exonic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1026676886 7:72435585-72435607 CGCTGCTGGCCTCTCCGCGCTGG - Intronic
1026850313 7:73719544-73719566 CGCCGCCAGCGCCAACGCGCCGG - Intronic
1029456216 7:100673840-100673862 CGCCGCCGCCGCCTCCGCCGCGG + Exonic
1029456218 7:100673843-100673865 CGCCGCCGCCTCCGCCGCGGAGG + Exonic
1032215258 7:129952611-129952633 GGCCGCGGGCTCCTCAGAGCCGG - Exonic
1033595333 7:142854929-142854951 CGGCGCCCGCTCCTCCGCCCCGG - Intergenic
1034491617 7:151396016-151396038 GGCCGCGGCCTCCTCCGCGCAGG + Exonic
1034977611 7:155457608-155457630 CGCCGCCTCGGCCTCCGCGCGGG - Intergenic
1035291783 7:157844011-157844033 CGCCGCCCCCTCCTCCGTGCAGG - Intronic
1035515798 8:231837-231859 CGCCGGCAGCTGTTCCGCGCGGG - Intergenic
1035601027 8:896732-896754 CACTGCCGTCACCTCCGCGCTGG + Intergenic
1037065077 8:14567166-14567188 CGCCCCCTGCTCCACAGCGCCGG + Intronic
1037535224 8:19817434-19817456 CGCCGCCGCCGCCACCGCGGGGG - Exonic
1037855371 8:22367500-22367522 CGGCGCCCGGTCCTCGGCGCAGG - Intronic
1038554089 8:28494451-28494473 TGCTGCTGGCTCCTCGGCGCGGG - Intronic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1041686939 8:60652600-60652622 CGCCCCCGGCTCGCCCGCGCCGG - Intergenic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1042722517 8:71841694-71841716 CCCTGCGCGCTCCTCCGCGCGGG + Exonic
1043472589 8:80578038-80578060 CGCGGCCGGCGCCTCCCCTCCGG + Intergenic
1043502787 8:80873795-80873817 CGCCGCCGCCGCCTCGTCGCCGG - Intronic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1045547365 8:103140795-103140817 CGCCGCCGCCGCCTCCTTGCGGG + Exonic
1047393693 8:124474931-124474953 CGCCGCCTGCTCCACCTCGAGGG + Exonic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1048484320 8:134832608-134832630 CGCCCACGGCTCCTCCTCACGGG - Intergenic
1049554704 8:143276035-143276057 GCCCGCCGGCCGCTCCGCGCTGG - Exonic
1050472386 9:6007440-6007462 CGCCACCTCCTCCTCCGCGGTGG + Exonic
1051206311 9:14693108-14693130 CGCCCGCCGCTCCTCCGCGCCGG - Intronic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1055611890 9:78031962-78031984 CGCCGCCGCCTCCTCCCTCCCGG - Intergenic
1056643377 9:88388895-88388917 CGCCGCCGCCCCCTGCCCGCCGG - Intronic
1057605713 9:96496673-96496695 CCCCGCTGGCTCCACCGCCCAGG + Intronic
1058467627 9:105244883-105244905 CTCCGCCTCCTCCGCCGCGCAGG + Exonic
1058508851 9:105694551-105694573 GGCCGCCCGCTCCTCCGCGCCGG - Exonic
1059119727 9:111631294-111631316 AGCAGCCGACGCCTCCGCGCAGG - Intergenic
1060584480 9:124777453-124777475 AGCTCCCGGCTCCTCCGCCCTGG - Intronic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1061449225 9:130659680-130659702 CTCCGCCGGCAGCCCCGCGCAGG + Intergenic
1061559696 9:131394413-131394435 CGCCGCCGCCTCCTTCCCGCCGG + Intronic
1062592304 9:137279855-137279877 CGCGGCCAGGTTCTCCGCGCGGG - Exonic
1062696345 9:137877996-137878018 CCCCGCCGGCCCCGCCGCCCCGG - Exonic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1203792624 EBV:159934-159956 CCCCGCCAGCGCCTCCTCGCAGG + Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1189407118 X:40735355-40735377 CCCCGCCGCCGCCTCCGGGCGGG + Exonic
1189821501 X:44873426-44873448 CGCCGCCTCCTCCTCCGCCGCGG - Intronic
1190062255 X:47219047-47219069 CGCCCCAGGCGCCGCCGCGCCGG + Intronic
1191213188 X:57910006-57910028 CCCCGCGGGCTGCTCTGCGCAGG - Exonic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1196616193 X:117769362-117769384 CGCCCCCTGCTCCACTGCGCTGG + Intergenic
1199832899 X:151562734-151562756 GGCCGTCGGCTCCTGTGCGCAGG - Intergenic
1200229538 X:154437163-154437185 CGCCGCCGCCGCCACCGCACTGG - Exonic
1200292669 X:154887051-154887073 CGCCGCCGGCACCCCAGCCCGGG + Exonic
1200339513 X:155382791-155382813 CGCCGCCGGCACCCCAGCCCGGG + Exonic
1200346957 X:155457902-155457924 CGCCGCCGGCACCCCAGCCCGGG - Exonic