ID: 921936027

View in Genome Browser
Species Human (GRCh38)
Location 1:220797920-220797942
Sequence CGCTGGCGGATCTCAACTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921936025_921936027 -9 Left 921936025 1:220797906-220797928 CCTTTCTGAGGCGTCGCTGGCGG 0: 1
1: 0
2: 1
3: 2
4: 47
Right 921936027 1:220797920-220797942 CGCTGGCGGATCTCAACTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 178
921936023_921936027 2 Left 921936023 1:220797895-220797917 CCATTCTTGATCCTTTCTGAGGC 0: 1
1: 0
2: 1
3: 17
4: 233
Right 921936027 1:220797920-220797942 CGCTGGCGGATCTCAACTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 178
921936020_921936027 7 Left 921936020 1:220797890-220797912 CCAGCCCATTCTTGATCCTTTCT 0: 1
1: 0
2: 2
3: 37
4: 396
Right 921936027 1:220797920-220797942 CGCTGGCGGATCTCAACTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 178
921936021_921936027 3 Left 921936021 1:220797894-220797916 CCCATTCTTGATCCTTTCTGAGG 0: 1
1: 0
2: 5
3: 28
4: 207
Right 921936027 1:220797920-220797942 CGCTGGCGGATCTCAACTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921936027 Original CRISPR CGCTGGCGGATCTCAACTCC AGG Exonic
900147007 1:1162788-1162810 CGCTGGCCAATCTCCGCTCCTGG - Intergenic
900249996 1:1663696-1663718 AGCTGGCGGATCACAAGGCCAGG - Exonic
900433688 1:2616124-2616146 CCCGGGCTGGTCTCAACTCCTGG - Intronic
901487410 1:9574298-9574320 CCCAGGCTGGTCTCAACTCCTGG + Intronic
902430169 1:16356772-16356794 CTCAGGTTGATCTCAACTCCTGG - Intronic
905425745 1:37882885-37882907 GGCTGGGGGACCTCAACTACAGG - Exonic
907061643 1:51432376-51432398 CCCAGGGTGATCTCAACTCCTGG + Intronic
908731974 1:67235600-67235622 CCCAGGCTGGTCTCAACTCCTGG + Intronic
912380512 1:109245597-109245619 CACAGGCTGATCTCAAATCCTGG - Intergenic
913965463 1:143373677-143373699 GGCTGGCGGATCACAAGGCCAGG - Intergenic
914059837 1:144199281-144199303 GGCTGGCGGATCACAAGGCCAGG - Intergenic
914119313 1:144767088-144767110 GGCTGGCGGATCACAAGGCCAGG + Intergenic
915116942 1:153607328-153607350 CCCTGGGGGGTCTCAGCTCCTGG - Exonic
916655811 1:166874574-166874596 CCCAGGCTGATCTCAAATCCTGG - Intronic
917533139 1:175854982-175855004 CCCTGGCTGATCTCAAACCCTGG + Intergenic
920262704 1:204700239-204700261 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
921641344 1:217558737-217558759 CCCAGGCTGCTCTCAACTCCTGG - Intronic
921936027 1:220797920-220797942 CGCTGGCGGATCTCAACTCCAGG + Exonic
923737426 1:236624061-236624083 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1064531128 10:16311051-16311073 CGTAGGCTGGTCTCAACTCCTGG + Intergenic
1065205299 10:23351735-23351757 CCCTGGCTGGTCTAAACTCCTGG - Intergenic
1066368251 10:34797359-34797381 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1069503382 10:68974874-68974896 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1069801944 10:71087103-71087125 TGCTGGGAGATCTCAGCTCCTGG + Intergenic
1071154929 10:82677259-82677281 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1073270328 10:102257521-102257543 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1073427701 10:103465944-103465966 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1076600455 10:131653791-131653813 CGCTGGAGCATCTGAACTCCTGG - Intergenic
1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG + Intronic
1077334065 11:1995626-1995648 CGCTGGAGGAGCTCAGCTCTGGG + Intergenic
1077620724 11:3720458-3720480 GCCTGGCAGATCTCAACTCCTGG - Intronic
1079950626 11:26798896-26798918 CCCTGGCAGGTCTCAACTTCTGG + Intergenic
1082818179 11:57524560-57524582 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1083273333 11:61583016-61583038 CTCAGGCTGGTCTCAACTCCTGG - Intergenic
1083783514 11:64930652-64930674 CCCTGGAGGATCTGACCTCCAGG - Intronic
1084329045 11:68419441-68419463 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1086102612 11:83116859-83116881 CCCTGGCTGGTCTCAAGTCCTGG + Intergenic
1202817048 11_KI270721v1_random:50808-50830 CGCTGGAGGAGCTCAGCTCTGGG + Intergenic
1091729714 12:2871435-2871457 CCCAGGCTGATTTCAACTCCTGG - Intronic
1092341120 12:7677038-7677060 CCCAGGCTGATCTGAACTCCTGG + Intergenic
1092535844 12:9386338-9386360 CCCAGGCTGATCTCAACTCCTGG + Intergenic
1092732991 12:11551826-11551848 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1094629437 12:32158413-32158435 CCCAGGCTGATCTCAATTCCTGG - Intronic
1100314969 12:93436668-93436690 CTCAGGCTGGTCTCAACTCCTGG + Intronic
1102058132 12:109912021-109912043 CGCTGGCGGATCACAAGGTCAGG - Intronic
1102140674 12:110612601-110612623 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1102147238 12:110663391-110663413 CGCAGGCTGGTCTCAGCTCCTGG - Intronic
1102944187 12:116971152-116971174 CCCAGGCTGGTCTCAACTCCTGG - Intronic
1106702057 13:32239928-32239950 CCCAGGCTGATCTCAACTCTTGG + Intronic
1107733424 13:43370962-43370984 CGCTGGCTGATCCCAGTTCCAGG - Intronic
1110553686 13:76834867-76834889 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1115691510 14:35849062-35849084 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1119992891 14:79219337-79219359 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1122058825 14:99123233-99123255 CCCTGGCTGATCTCATCTCAGGG - Intergenic
1122480141 14:102041859-102041881 CGCTGCAGATTCTCAACTCCTGG + Intronic
1123125826 14:105945337-105945359 CGCTGGGGCACCTCAGCTCCAGG - Intergenic
1124355376 15:28991454-28991476 AGCTGGCAGAGCTCAACACCTGG - Intronic
1124576612 15:30914573-30914595 CCCAGGCTGGTCTCAACTCCCGG + Intronic
1126949841 15:53868906-53868928 CTCAGGCTGGTCTCAACTCCTGG - Intergenic
1127663306 15:61120468-61120490 GGCGGGCGGATCACAACTTCAGG + Intronic
1128825265 15:70710046-70710068 CCCAGGCTGGTCTCAACTCCTGG - Intronic
1131787065 15:95924686-95924708 GGCTGGCGGATCACAAGTTCAGG + Intergenic
1134783715 16:16921952-16921974 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1136857105 16:33667272-33667294 CCCAGGCTGATCTCAACTCCTGG - Intergenic
1137289727 16:47043729-47043751 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1137389285 16:48067973-48067995 CCCTGGGGAGTCTCAACTCCAGG - Intergenic
1138127845 16:54453443-54453465 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1139459166 16:67108549-67108571 CCCAGGCTGGTCTCAACTCCCGG + Intergenic
1139772087 16:69286158-69286180 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1140554549 16:75906724-75906746 GGCTGGCGGATCACAAGTTCAGG + Intergenic
1203118677 16_KI270728v1_random:1515747-1515769 CCCAGACTGATCTCAACTCCTGG - Intergenic
1143050543 17:4121924-4121946 CCCTGGCTGGTCTCAACTCGTGG + Intronic
1145873209 17:28293858-28293880 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1146753879 17:35408867-35408889 CTCAGGCCGGTCTCAACTCCTGG - Intergenic
1148009130 17:44461391-44461413 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1149269904 17:54966964-54966986 CTCAGGCTGGTCTCAACTCCTGG - Intronic
1151446642 17:74170281-74170303 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1151578403 17:74964064-74964086 GGCTGGCCGACCCCAACTCCAGG - Intronic
1155066671 18:22274214-22274236 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1156606028 18:38668423-38668445 GGCAGGCGGATCTCAAGTTCAGG + Intergenic
1156724394 18:40110521-40110543 CCCAGGCCAATCTCAACTCCTGG - Intergenic
1158667538 18:59446312-59446334 CTCTGGAGGAAGTCAACTCCAGG - Intronic
1161162553 19:2769188-2769210 TGCTGGCTGATCTCAGCTCCAGG + Intronic
1161884749 19:6985758-6985780 GGCGGGCGGATCTCGAGTCCAGG + Intergenic
1162101973 19:8344240-8344262 CCCAGGCTGGTCTCAACTCCTGG - Intronic
1163424334 19:17232801-17232823 CCCTGGCTGGTCTCAAATCCTGG - Intronic
1166007764 19:39918867-39918889 CCCAGGCTGATCTCAACTCCTGG + Intronic
1168283819 19:55320752-55320774 GGCTGGGGGATCTGGACTCCTGG - Intronic
1202699242 1_KI270712v1_random:151163-151185 GGCTGGCGGATCACAAGGCCAGG - Intergenic
925380038 2:3418478-3418500 CGCTGGCGGATCCCAGGTCTAGG - Intronic
926203508 2:10818374-10818396 CCCAGGCTGGTCTCAACTCCTGG + Intronic
926721940 2:15967379-15967401 AGCTGGCAGATTTCACCTCCTGG - Intergenic
928046801 2:27942575-27942597 CCCAGGCTGATCTGAACTCCTGG + Intronic
930077172 2:47415856-47415878 CCCAGGCTGGTCTCAACTCCTGG - Intronic
931560114 2:63551999-63552021 CCCAGGCTGGTCTCAACTCCTGG + Intronic
931655447 2:64507301-64507323 AGGTGGCGGTTCTCAGCTCCTGG - Intergenic
933943276 2:87262968-87262990 CGCTTTGGGATCTCATCTCCTGG + Intergenic
934170190 2:89534648-89534670 GGCTGGCGGATCACAAGGCCAGG - Intergenic
934280492 2:91608972-91608994 GGCTGGCGGATCACAAGGCCAGG - Intergenic
936336938 2:111598593-111598615 CGCTTTGGGATCTCATCTCCTGG - Intergenic
937732795 2:125255225-125255247 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
939750135 2:146033988-146034010 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
944188550 2:196976655-196976677 TGCAGGCTGATCTTAACTCCTGG - Intronic
946223360 2:218247987-218248009 GCCAGGCTGATCTCAACTCCTGG + Intronic
946851682 2:223913168-223913190 TCCAGGCTGATCTCAACTCCTGG - Intronic
947786032 2:232821038-232821060 GGCAGGCTGGTCTCAACTCCTGG + Intronic
1169464954 20:5829083-5829105 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1169888306 20:10426605-10426627 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1172074835 20:32287528-32287550 CTCAGGCTGGTCTCAACTCCTGG + Intronic
1173240251 20:41289208-41289230 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1174645015 20:52078279-52078301 CCCAGGCTGGTCTCAACTCCTGG - Intronic
1175553111 20:59829609-59829631 CGCTGGGGAATCCCATCTCCAGG + Intronic
1176155095 20:63615533-63615555 CTCGGGCTGGTCTCAACTCCTGG + Intronic
1176603757 21:8813652-8813674 CGCTGCCGGATCTCCAATCAGGG + Intergenic
1180621583 22:17166244-17166266 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
950513547 3:13448396-13448418 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
953565296 3:44027250-44027272 GGCTGGCCTGTCTCAACTCCTGG + Intergenic
954263138 3:49454472-49454494 CCCTGGCTGGTCTGAACTCCTGG + Intergenic
960632734 3:119749311-119749333 CCCAGGCTGGTCTCAACTCCTGG - Intronic
961162878 3:124744616-124744638 CCCAGGCTGGTCTCAACTCCTGG + Exonic
961812465 3:129529711-129529733 TGCTTGCGGTTCTCAACACCAGG - Intronic
962470962 3:135708252-135708274 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
962527915 3:136252710-136252732 CCCAGGCTGGTCTCAACTCCTGG + Intronic
962528081 3:136253855-136253877 CCCAGGCTGGTCTCAACTCCTGG + Intronic
964628050 3:158777917-158777939 AGCTGGTGGATCTCAAGTCTGGG + Intronic
965246159 3:166272546-166272568 GGCGGGCGGATCACAACTTCAGG + Intergenic
965455847 3:168899125-168899147 CCCAGGCTGATCTCAAGTCCTGG + Intergenic
967964613 3:194951217-194951239 CTGGGGTGGATCTCAACTCCAGG - Intergenic
971266869 4:25103472-25103494 CTCTGGGGGATGTCAGCTCCTGG + Intergenic
974649157 4:64731844-64731866 GGCTGGCGGATCACAAGTTCAGG + Intergenic
976949439 4:90811066-90811088 CGCGGGCGGATCACAACGTCAGG - Intronic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
982699787 4:158647657-158647679 CCCAGGCTGGTCTCAACTCCTGG - Intronic
983074760 4:163312574-163312596 CCCTGGCTGTTCTGAACTCCTGG + Intergenic
983561931 4:169110163-169110185 CCCAGGCTGCTCTCAACTCCTGG - Intronic
983578638 4:169285728-169285750 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
986929239 5:12797082-12797104 CGCTGGCTGCTCTTAGCTCCTGG - Intergenic
989385324 5:40849764-40849786 CCCAGGCTGGTCTCAACTCCTGG - Intronic
991629260 5:68638218-68638240 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
991733577 5:69611781-69611803 CCCAGGCTGATCTCAACTCCTGG + Intergenic
991810011 5:70466927-70466949 CCCAGGCTGATCTCAACTCCTGG + Intergenic
991861376 5:71016068-71016090 CCCAGGCTGATCTCAACTCCTGG - Intronic
991901400 5:71464284-71464306 CCCAGGCTGGTCTCAACTCCTGG - Intronic
991901538 5:71465470-71465492 CCCAGGCTGATCTCAACTCCTGG + Intronic
998403448 5:141860301-141860323 CCCAGGCTGGTCTCAACTCCTGG - Intronic
999779635 5:154838824-154838846 GGCTGGCGGATCACAAGGCCAGG - Intronic
1001729415 5:173939076-173939098 CCCAGGCTGGTCTCAACTCCTGG - Intronic
1002548544 5:179969656-179969678 TTCAGGCGGGTCTCAACTCCTGG - Intronic
1003188180 6:3850483-3850505 CGCCGGCGGAGCGCAGCTCCAGG - Exonic
1004005710 6:11635630-11635652 CCCAGGCTGGTCTCAACTCCAGG - Intergenic
1006633881 6:35448632-35448654 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1007038980 6:38703917-38703939 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1007535979 6:42589071-42589093 GGCTGGAGGATCCCAAGTCCAGG - Intronic
1011307077 6:85939202-85939224 CTCAGGCTGGTCTCAACTCCTGG - Intergenic
1011669100 6:89665234-89665256 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1015310113 6:131757461-131757483 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1023822346 7:43987146-43987168 GCCAGGCGGGTCTCAACTCCTGG - Intergenic
1026148086 7:67765492-67765514 CCCAGGCTGATCTAAACTCCTGG - Intergenic
1027123737 7:75541053-75541075 CCCAGGCTGGTCTCAACTCCTGG - Intronic
1027558522 7:79696736-79696758 GGCAGGAGGATCTCAAGTCCAGG - Intergenic
1029136497 7:98376292-98376314 CCCAGGCTGTTCTCAACTCCTGG - Intronic
1029629490 7:101741517-101741539 CCCAGGCTGATCTCAACTCCTGG - Intergenic
1029750609 7:102540565-102540587 GCCAGGCGGGTCTCAACTCCTGG - Intronic
1029768562 7:102639673-102639695 GCCAGGCGGGTCTCAACTCCTGG - Intronic
1032318684 7:130865140-130865162 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1032947797 7:136871415-136871437 CGCTGGCGCATCCCAGCACCAGG - Intronic
1034648674 7:152671830-152671852 CCCAGGCTGGTCTCAACTCCTGG - Intronic
1035420316 7:158724261-158724283 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1037932119 8:22887554-22887576 CCCAGGCTGGTCTCAACTCCTGG - Intronic
1045632806 8:104146153-104146175 CCCGGGCTGGTCTCAACTCCTGG - Intronic
1050542483 9:6682043-6682065 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1051686783 9:19666194-19666216 CCCACGCTGATCTCAACTCCTGG - Intronic
1053128567 9:35602305-35602327 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1053202970 9:36165221-36165243 GGCTGGCAGATCTCGCCTCCTGG - Intergenic
1053246689 9:36540490-36540512 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1053385609 9:37684961-37684983 CCCAGGCTGGTCTCAACTCCTGG + Intronic
1053661174 9:40280852-40280874 CTCTGGCTGATCTCAAATTCTGG + Intronic
1054373292 9:64427067-64427089 CTCTGGCTGATCTCAAATTCTGG + Intergenic
1054523436 9:66095432-66095454 CTCTGGCTGATCTCAAATTCTGG - Intergenic
1054680925 9:67916845-67916867 CTCTGGCTGATCTCAAATTCTGG + Intergenic
1059577102 9:115501708-115501730 CGCTGGCGGATCACAAGGTCAGG + Intergenic
1061017170 9:127988426-127988448 CGCGGGCTGGTCTAAACTCCTGG + Intergenic
1061127767 9:128687886-128687908 CGCTGGCCAATTTCAAATCCTGG - Intronic
1061218892 9:129237461-129237483 CCCTGGGGGTTCTCCACTCCTGG + Intergenic
1185973051 X:4685959-4685981 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1188347716 X:29087824-29087846 CCCAGGCCGGTCTCAACTCCTGG - Intronic
1188965882 X:36550548-36550570 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1189436359 X:40996374-40996396 CCCAGGCTGGTCTCAACTCCTGG + Intergenic
1191838851 X:65494551-65494573 CGCTGGCGGATCACAAGTTCAGG + Intronic
1192745828 X:73937872-73937894 CCCAGGCTGGTCTCAACTCCTGG - Intergenic
1194780476 X:98019562-98019584 CCCCTGTGGATCTCAACTCCTGG + Intergenic
1200566771 Y:4778506-4778528 AGCTGGAGTATCTAAACTCCTGG - Intergenic