ID: 921936648

View in Genome Browser
Species Human (GRCh38)
Location 1:220802207-220802229
Sequence TGTCCACCCAGGACTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921936642_921936648 7 Left 921936642 1:220802177-220802199 CCCTCTGTCACCTGACATAGGTC 0: 1
1: 0
2: 2
3: 9
4: 111
Right 921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG 0: 1
1: 0
2: 3
3: 28
4: 238
921936640_921936648 19 Left 921936640 1:220802165-220802187 CCTGCAGCATCGCCCTCTGTCAC 0: 1
1: 0
2: 1
3: 14
4: 153
Right 921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG 0: 1
1: 0
2: 3
3: 28
4: 238
921936643_921936648 6 Left 921936643 1:220802178-220802200 CCTCTGTCACCTGACATAGGTCC 0: 1
1: 0
2: 1
3: 8
4: 100
Right 921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG 0: 1
1: 0
2: 3
3: 28
4: 238
921936644_921936648 -3 Left 921936644 1:220802187-220802209 CCTGACATAGGTCCCTCAAATGT 0: 1
1: 0
2: 0
3: 2
4: 94
Right 921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG 0: 1
1: 0
2: 3
3: 28
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921936648 Original CRISPR TGTCCACCCAGGACTCCCTC TGG Intronic
900414200 1:2527661-2527683 CTTCCACCCAGGCCTCCCTGGGG - Intergenic
900486604 1:2925559-2925581 TGTGCACCCTGGAATCCCACAGG + Intergenic
900882834 1:5394214-5394236 GGACGACCCAGGACTGCCTCTGG - Intergenic
901098614 1:6702081-6702103 GATCCAGCCAGGACTCCCTAGGG + Intergenic
901686767 1:10947625-10947647 GGTGCACCCAGGACTCACCCTGG + Exonic
901876229 1:12168418-12168440 AGGCCACCCAGGACTTACTCTGG - Intronic
902977404 1:20098863-20098885 TGGCCCCCCAGGACTCCCACTGG + Intergenic
904079556 1:27863394-27863416 TGTCCTCCCAGCACTCACACAGG - Intergenic
904916397 1:33973475-33973497 ATTCAACCCAGGACCCCCTCAGG - Intronic
909891693 1:81015585-81015607 TGTCCAACAAGGAACCCCTCTGG + Intergenic
911318978 1:96388998-96389020 TTTCCACCCTGGACTCTTTCAGG + Intergenic
912547423 1:110460944-110460966 AGCCCACCCCGGCCTCCCTCTGG - Intergenic
913486096 1:119333798-119333820 TGCCCACCCAGAACTCGCGCTGG - Intergenic
913645754 1:120852311-120852333 TGTAATCCCAGCACTCCCTCAGG + Intergenic
914080887 1:144410566-144410588 TGTAATCCCAGCACTCCCTCAGG - Intergenic
914175801 1:145279097-145279119 TGTAATCCCAGCACTCCCTCAGG - Intergenic
914530520 1:148520582-148520604 TGTAATCCCAGCACTCCCTCAGG - Intergenic
914676446 1:149910365-149910387 TCTCCACCCAAGAACCCCTCAGG + Intronic
915590671 1:156868481-156868503 TGGCCACCCAGGACGCCCGAGGG - Intronic
917113702 1:171579445-171579467 TTTCCAACCAGGTCTCTCTCAGG + Exonic
918381223 1:183957368-183957390 TGGCCACCAAGGACTAGCTCTGG - Intronic
921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG + Intronic
924305921 1:242689472-242689494 TGCCCACCCAGAACTCACGCTGG - Intergenic
924722681 1:246637994-246638016 TGTCACCCCAGGGCTCCCTCTGG - Intronic
924742040 1:246800010-246800032 AGTCCTCCGTGGACTCCCTCAGG + Intergenic
1062874317 10:932225-932247 TGGCCACCCAGGACACGCCCTGG + Intergenic
1065146932 10:22779076-22779098 TTTGCACCCAGCACTTCCTCTGG + Intergenic
1068455515 10:57249884-57249906 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1069751646 10:70748884-70748906 TGGCCACCCTGGACTTCCTAGGG - Intronic
1069840304 10:71335553-71335575 TGTCCACCCAGTCTCCCCTCGGG - Intronic
1069930941 10:71881138-71881160 TGTGCACCCAGGACTCTGCCTGG - Intergenic
1070744399 10:78924224-78924246 TGTCCACTCAGTACTGACTCAGG - Intergenic
1071078697 10:81784263-81784285 TGCCCACCCAGAACTCACGCTGG - Intergenic
1072818815 10:98536102-98536124 TGTCCATGCAGGACTTCCTAAGG - Intronic
1073001449 10:100288980-100289002 TGCCCACCCTGGACTCCCCAGGG + Exonic
1073878291 10:107950623-107950645 TGCCCACCCAGAACTCGCGCTGG - Intergenic
1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG + Intronic
1076852269 10:133099045-133099067 TGTCCCCCCAGCACTTTCTCCGG - Intronic
1076852307 10:133099153-133099175 TGTCCCCCCAGCACTTTCTCCGG - Intronic
1076852320 10:133099189-133099211 TGTCCCCCCAGCACTTTCTCCGG - Intronic
1077485612 11:2837208-2837230 TCTCCACCCAGGCCTCTCCCCGG - Intronic
1080106046 11:28512647-28512669 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1081136173 11:39442378-39442400 CGCCCACCCAGAACTCCCCCTGG + Intergenic
1081540744 11:44032907-44032929 TCTCCACCCGCGTCTCCCTCGGG - Intergenic
1081911895 11:46705130-46705152 TGGCCAACCAGGGCTCCCTGCGG + Exonic
1082622756 11:55444464-55444486 TGTCCTCCCAGGCCTCTCTCAGG + Intergenic
1082794917 11:57371778-57371800 TCTCCACCTGGGACTCCCCCAGG + Intergenic
1089025608 11:115266443-115266465 TGTGAACCCAGCACTCCCACGGG - Intronic
1089100849 11:115961349-115961371 TTTCCTCCCAAGGCTCCCTCTGG + Intergenic
1089450012 11:118587823-118587845 TGGCCTCCCACGACCCCCTCTGG + Intronic
1090260363 11:125314807-125314829 TGTCCAGCCAGGGCTGCCCCGGG - Intronic
1091885951 12:4017164-4017186 GGTCCAGCAAGGACTCCATCAGG + Intergenic
1094405379 12:30110764-30110786 TGCCCACCCGGAACTCCCGCTGG + Intergenic
1095123072 12:38441997-38442019 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1096694248 12:53338748-53338770 TGTCAACATAGGACACCCTCTGG + Intronic
1099636317 12:85217949-85217971 TATCCAACCTAGACTCCCTCAGG - Intronic
1099861948 12:88232667-88232689 TGTCACCCCAGGATTCCCTCTGG + Intergenic
1101042585 12:100771735-100771757 TGGTCACCCAGGCCTTCCTCAGG - Intronic
1101412844 12:104483544-104483566 TGTCCATGCAGCAATCCCTCAGG + Intronic
1108099205 13:46936370-46936392 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1108991165 13:56659425-56659447 TGCCCACCCAGAACTCGCGCTGG + Intergenic
1109124726 13:58504542-58504564 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1109145383 13:58773362-58773384 TGCCCACCCAGAACTCACGCTGG - Intergenic
1112503264 13:99957868-99957890 TGTCCATTCAGGGCTCCCTCTGG - Intergenic
1113815581 13:113168271-113168293 TGTAAATCCAGGCCTCCCTCTGG + Intronic
1113842859 13:113370165-113370187 CGGCCACCCCGGGCTCCCTCAGG + Intergenic
1114155525 14:20099243-20099265 TGCCCACCCAGAAGTCACTCTGG - Intergenic
1114236913 14:20832015-20832037 TGTCACCCCAGGGCTCCCTCTGG - Intergenic
1114454321 14:22845439-22845461 TTTCCACACAGCACTCCCTCAGG - Intronic
1115779970 14:36758381-36758403 TGGCCACAGAAGACTCCCTCTGG + Intronic
1115882295 14:37933160-37933182 TGTATACCCATGAGTCCCTCAGG - Intronic
1116310983 14:43326649-43326671 CGCCCACCCAGGACTCACGCTGG - Intergenic
1117072243 14:52068122-52068144 TCTCCACTCAGGACTTCCCCAGG - Exonic
1118662133 14:68026097-68026119 TGTTCACCCAGGACTTATTCAGG + Intronic
1118942326 14:70349220-70349242 TGTCACCCCAGGGCTCCCTCCGG + Intronic
1120229792 14:81829771-81829793 TGTCCACCCAGAACTTGCTCTGG + Intergenic
1122204786 14:100143039-100143061 TGTCAACTCAGGCCTCTCTCTGG - Intronic
1123035801 14:105471436-105471458 GGTCCGCCCAGGCCTCGCTCAGG + Intergenic
1124110620 15:26781942-26781964 CGCCCACCCAGGACTCACGCTGG + Intronic
1124387869 15:29225062-29225084 TGCCCACCCAGAACTCACGCTGG + Intronic
1124552560 15:30695111-30695133 TGTCCTCCCAGGTCTCCCTCTGG + Intronic
1124678681 15:31710555-31710577 TGTCCTCCCAGGTCTCCCTCTGG - Intronic
1128064350 15:64755184-64755206 TTTCCAGCCAGGATTCCCTCTGG + Intronic
1128598599 15:68975985-68976007 TGCCCACCCAGAACTCCAGCTGG + Intronic
1129392914 15:75229468-75229490 AGTCCACCCAGTGCTCCCCCTGG + Intergenic
1131512832 15:93058871-93058893 TGTGCACCCAGGACTGCATAGGG + Intronic
1131679939 15:94710699-94710721 TGTCCACCTAGGCCTCCCAGTGG + Intergenic
1134270525 16:12729102-12729124 TCTCACCCCAGGGCTCCCTCTGG - Intronic
1135474172 16:22759364-22759386 TGTACATCCACCACTCCCTCAGG + Intergenic
1139633982 16:68246899-68246921 GGCCAACCCAGGACTCCCTGAGG - Intronic
1140094587 16:71864023-71864045 TGACAACCCAAGACTCCTTCAGG + Intronic
1140133666 16:72186059-72186081 GGTCCACCCATCATTCCCTCTGG + Intergenic
1144734030 17:17544971-17544993 GGCCCACCTTGGACTCCCTCTGG - Intronic
1144768144 17:17744140-17744162 TGTCCACCTAGGACTCCCTGTGG + Intronic
1145050334 17:19654631-19654653 CGCCCACCCAGAACTCGCTCTGG + Intronic
1147894287 17:43740335-43740357 TTCCCACCCAGGACCTCCTCAGG + Intergenic
1148509133 17:48153828-48153850 TGTCCATTTAGGACTTCCTCAGG - Intronic
1150830171 17:68512017-68512039 TGTCCACCCCACTCTCCCTCCGG - Intronic
1152080132 17:78181999-78182021 TGTCCACCTTGGCCTCCCACAGG + Intronic
1152901296 17:82942515-82942537 TTTCCACACCGGCCTCCCTCAGG - Exonic
1153523293 18:5972060-5972082 TGCCCATGCAGGACTCCCTTTGG - Intronic
1155044911 18:22095135-22095157 GGCCCACCCAGGAATCCCTCAGG - Intronic
1155657739 18:28210873-28210895 TGTCACCCCAGGGCTCCTTCCGG - Intergenic
1157454348 18:47812791-47812813 TGTCTCCCCAGGACCCCCACAGG + Exonic
1157920406 18:51708127-51708149 TGTCATCCCAGGGCTCCCTCTGG + Intergenic
1161124663 19:2549056-2549078 TGTCCCCCCTGGGGTCCCTCGGG - Intronic
1161265365 19:3361127-3361149 CCTCCAGCCAGGACCCCCTCGGG - Intronic
1162005778 19:7778039-7778061 TATCCACACAGGTTTCCCTCAGG + Intergenic
1162909305 19:13840773-13840795 TGTCCACCCAGGACACCAGGAGG + Intergenic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165255224 19:34573603-34573625 TGTGCACCCAGGAGGCCCTGAGG + Intergenic
1165267111 19:34669494-34669516 TGTGCACCCAGGAGGCCCTGAGG - Intronic
1166151820 19:40880548-40880570 TGCCCACCCCGAAGTCCCTCAGG + Exonic
1166713347 19:44951177-44951199 GTACCACCCTGGACTCCCTCAGG - Intronic
1167745970 19:51352059-51352081 TGTTCCCCCAGGAGACCCTCGGG - Intronic
1168327137 19:55544225-55544247 GGCCCACACAGAACTCCCTCAGG + Exonic
924991612 2:317420-317442 GGACCATCCAGGCCTCCCTCAGG - Intergenic
925036531 2:691601-691623 TGTCCACCCAAGACTACTTTGGG + Intergenic
925045728 2:771740-771762 TGTCCACCCAGGAGCCCGTGTGG - Intergenic
925045838 2:772532-772554 TGACCACCCAGGACACCAGCTGG + Intergenic
925454584 2:4004347-4004369 TTTTCACCCACTACTCCCTCAGG + Intergenic
925685969 2:6473989-6474011 TTTCCATCCAGGAATTCCTCTGG + Intergenic
927175714 2:20405818-20405840 TGGCCCCCCAGGAATCCCACTGG + Intergenic
927277732 2:21275751-21275773 AGTGGCCCCAGGACTCCCTCTGG - Intergenic
928805775 2:35152534-35152556 TGTTCACCCAGGAGTTACTCAGG + Intergenic
929964189 2:46521333-46521355 TGCCCACCAAGAACTCCCTGCGG - Intronic
933167701 2:79094056-79094078 TGTCACCTCAGGGCTCCCTCTGG - Intergenic
933375102 2:81468999-81469021 TGACCATCCAGGACCCCATCTGG + Intergenic
934896197 2:98122226-98122248 TGGCCAGCCTGGACTCCCTGTGG + Intronic
936016085 2:108960082-108960104 TGTCCACCCTGCACACCCTGTGG + Intronic
936940159 2:117876362-117876384 TGTGCACCCATGACAGCCTCAGG - Intergenic
938708140 2:133951822-133951844 TGCCTACCCTGGACTCCATCTGG + Intergenic
939288603 2:140164511-140164533 TGTCCACCAATGCCTCACTCAGG + Intergenic
939496332 2:142932087-142932109 TGTCACCCCAAGGCTCCCTCTGG - Intronic
941651236 2:168094700-168094722 TGTTCCCCCAGGACTCCCCAGGG + Intronic
942653854 2:178194771-178194793 TGCCCACCCACGCGTCCCTCGGG - Intronic
945040908 2:205743269-205743291 CTTCCACCCAGGAATACCTCTGG + Exonic
947963696 2:234260835-234260857 TTTCAACCCAGGACTCACTCTGG - Intergenic
1171098393 20:22355952-22355974 TGTTCACCCAGGAGTTACTCAGG - Intergenic
1172244115 20:33433965-33433987 TGTTCTCCCAGGACATCCTCAGG + Intronic
1174111182 20:48198931-48198953 TGTCCTCCCTGGCCTCTCTCAGG + Intergenic
1175814850 20:61878003-61878025 TGTCCACGAAGTCCTCCCTCTGG - Intronic
1175826165 20:61937720-61937742 AGTCAACCCAGGCCTCCCTCAGG + Exonic
1175921552 20:62452749-62452771 TCTCCACCCAGATCACCCTCTGG + Intergenic
1175963944 20:62650849-62650871 CGTTCAGCAAGGACTCCCTCAGG + Intronic
1177287113 21:19065455-19065477 TGTCCGCTCAGGACTCACTCAGG - Intergenic
1179189340 21:39109397-39109419 TGTCCACCCTGGACACAGTCGGG - Intergenic
1179667027 21:42919951-42919973 TGTCACCCCAGGGTTCCCTCTGG - Intergenic
1180920849 22:19520860-19520882 TGTCCACCTACCACTTCCTCTGG + Intergenic
1181029778 22:20144133-20144155 TGTCCACCCAGGGCTCTCCCTGG + Intronic
1182034307 22:27185815-27185837 TCTCCACCCAGGGCTTCCTTGGG - Intergenic
1182340902 22:29620013-29620035 TGGCCACCCCGGCCTCCCACTGG - Intronic
1183277287 22:36906880-36906902 TGTCCAGCCTGGGCTCTCTCTGG + Intergenic
1183294789 22:37023108-37023130 TGTCCAGCCTGGGCTCTCTCTGG - Exonic
1183577537 22:38701241-38701263 CGTCCAGGTAGGACTCCCTCAGG - Intronic
1183640662 22:39090614-39090636 CCTCCACCCAGGAAGCCCTCGGG + Intergenic
1183936067 22:41263100-41263122 TGTCTGCCCAGGAGGCCCTCTGG + Intronic
1184465291 22:44665401-44665423 CGTCCACCCAGGTCAGCCTCAGG + Intergenic
1185244161 22:49764364-49764386 GCTCCTCCCAGGGCTCCCTCGGG - Intergenic
953307634 3:41844480-41844502 TGCCCACCCAGAACTCCAGCTGG + Intronic
953674095 3:44986412-44986434 TGCCCACCCAGAACTCGCGCTGG + Intronic
954383795 3:50233756-50233778 AGTCCTCCAATGACTCCCTCAGG - Intronic
954416001 3:50393654-50393676 TGTCCACCCTGGAGGCCCTCAGG - Intronic
954505189 3:51063879-51063901 TGTCCTTCCCCGACTCCCTCTGG - Intronic
959973923 3:112437202-112437224 TGTCCCCCCAGGAAACACTCAGG + Intergenic
960761699 3:121078869-121078891 TGCCCACCCAGAACTCCAGCTGG + Intronic
960992394 3:123320465-123320487 TGTGCACACATGGCTCCCTCAGG - Intronic
961688228 3:128650361-128650383 TGGCCACCCAGGACTCCTCGCGG + Intronic
962743038 3:138377231-138377253 TGCCCACCCAGGCCTTCCTCGGG + Intronic
965256762 3:166424020-166424042 TGCCCACCCAGAACTCACGCTGG - Intergenic
965872655 3:173279867-173279889 TGTCACCCCAGGGCTCCCTCTGG + Intergenic
966468950 3:180265634-180265656 TGTTCACCCAGGACTTACTTAGG - Intergenic
967555250 3:190849342-190849364 GTTCCACCCAAGACTCCCTGTGG + Intergenic
968412825 4:404274-404296 CGTCCACCCAGAACTCACACTGG + Intergenic
968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG + Intronic
968689985 4:1985419-1985441 TGACCACCCAGCACCCCCACAGG + Intronic
968919581 4:3515593-3515615 TGCCCACCCAGGACCCCCGATGG + Intronic
969017687 4:4115446-4115468 TGCCCACCCAGAACTCCAGCAGG - Intergenic
970294173 4:14610646-14610668 TGTCCTCCCAGGACATCATCTGG + Intergenic
970692021 4:18630886-18630908 TGCCCACCCAGAACTCACGCTGG + Intergenic
970794205 4:19892301-19892323 TGTCACCCCAGAGCTCCCTCTGG + Intergenic
972995075 4:44869864-44869886 TCCCCAACCAGGCCTCCCTCTGG + Intergenic
979308293 4:119173831-119173853 TGCCCACCCAGAACTCCAGCTGG - Intronic
979531832 4:121776597-121776619 TGCCTACCCAAGCCTCCCTCTGG + Intergenic
981960373 4:150530464-150530486 AGTCTAACCAGTACTCCCTCAGG - Intronic
982475928 4:155850425-155850447 TGACTACCCCGGACTACCTCAGG + Intronic
985724366 5:1508052-1508074 TGTCTGCCAAGGACCCCCTCCGG - Intronic
985873759 5:2579303-2579325 TGCCCACCCAAGACTCCAGCGGG - Intergenic
986226947 5:5824609-5824631 TGTCACCTCAGGACTCCCTGTGG + Intergenic
986626138 5:9725354-9725376 TGCCTACCCAGAACTCCCACTGG - Intergenic
986996789 5:13616170-13616192 TATCTACCCAGGAGTCCTTCAGG - Intergenic
987876924 5:23691170-23691192 CGTCCACCCAGAACTCCAGCTGG - Intergenic
990020117 5:51116403-51116425 TGTCCACTCAGGAGACCTTCAGG + Intergenic
990184940 5:53202237-53202259 TCTCCAACCAGGACCCCCACTGG + Intergenic
990243234 5:53837017-53837039 TGCCCACCCAGAACTCACGCTGG - Intergenic
992048841 5:72925537-72925559 TGCCCACCCAGAACTCGCACTGG - Intergenic
994606240 5:101970894-101970916 ATTCCTCCCAGGACTCCATCAGG + Intergenic
995566342 5:113435555-113435577 TGTCCACACAGGTGACCCTCAGG + Intronic
996478719 5:123949502-123949524 TGCCCACCCGGAACTCCCGCTGG + Intergenic
997668522 5:135651361-135651383 GTTTCCCCCAGGACTCCCTCAGG + Intergenic
998162715 5:139822503-139822525 TGACCACCCTGGACCCACTCTGG - Intronic
1001245374 5:170102155-170102177 TGTCCAAGAAGGCCTCCCTCTGG + Intergenic
1001282054 5:170393152-170393174 TGTCACCCCATGACTCCCTTGGG + Intronic
1001839432 5:174862191-174862213 TGTTTACCCAGGAGTCCTTCAGG + Intergenic
1003241615 6:4350244-4350266 TGTCTGCCTAGGACTCGCTCAGG + Intergenic
1003591600 6:7441320-7441342 AGCCCACCCAGAACTCGCTCTGG - Intergenic
1005352609 6:24951140-24951162 TGACCACCCACTACTCTCTCAGG - Intronic
1008284371 6:49629863-49629885 TGCCCACCCAGAACTCCAGCTGG + Intronic
1010270347 6:73910034-73910056 TGCCCACCCAGAACTCACACTGG - Intergenic
1013080208 6:106805811-106805833 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1015368314 6:132422801-132422823 TATCTACCCAGGAATCACTCAGG + Intergenic
1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG + Exonic
1016217170 6:141618258-141618280 CGCCCACCCAGAACTCCCGCTGG - Intergenic
1017015855 6:150099011-150099033 TGTCACCCCAGGGCTCCCTCTGG + Intergenic
1017895971 6:158680201-158680223 TTACCACCCATGACTCCCTCTGG + Intronic
1018162904 6:161064924-161064946 TGTCCAAACAGGTTTCCCTCAGG + Intronic
1018425010 6:163671918-163671940 TGCCCACCCAGCACTGCCTTGGG - Intergenic
1018901212 6:168052679-168052701 TGACCAGCCAGGCCTCCCGCTGG - Intergenic
1019530252 7:1499609-1499631 TGTACATCGAGGACTCCCTGGGG - Exonic
1020999882 7:15315578-15315600 TGCCCACCTAGGCCTCCCACAGG + Intronic
1022003714 7:26248487-26248509 CGTCACCCCAGGGCTCCCTCCGG + Intergenic
1023359446 7:39400430-39400452 TTTCTTCCAAGGACTCCCTCAGG + Intronic
1023607397 7:41942884-41942906 AGGCAGCCCAGGACTCCCTCTGG + Intergenic
1024256097 7:47540988-47541010 TGTCCTCCCAGGACTGCCAGGGG - Intronic
1024961380 7:54980684-54980706 TCTCCCCCCAGGACGCCCTCGGG + Intergenic
1026873268 7:73865983-73866005 TGTGAGCCCAGGACTGCCTCTGG + Intergenic
1030035021 7:105401643-105401665 TGTCCACCTAGGCCTCCCAAAGG + Intergenic
1033647332 7:143315609-143315631 TGTCCACCCAGGGTTCTGTCTGG - Intergenic
1037898049 8:22671343-22671365 TGTCCTCCCAGGAGTCTGTCTGG + Intergenic
1038870672 8:31489902-31489924 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1040311288 8:46238137-46238159 AGCCCACCCAGGACACCCTGGGG - Intergenic
1040952729 8:52953171-52953193 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1040953980 8:52961439-52961461 TGCCCACCCAGAACTCGCACTGG - Intergenic
1041743357 8:61179731-61179753 TATTCACCCAGGAGTCCTTCAGG - Intronic
1042158455 8:65868409-65868431 TGTCATCCCAGGTCTCCCTCTGG + Intergenic
1045131969 8:99163714-99163736 TGTCCACACAGAACTCCAGCTGG + Intronic
1046285066 8:112083249-112083271 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1046454766 8:114443496-114443518 TGTTCACCCAGGAGTTCTTCAGG - Intergenic
1047209677 8:122831289-122831311 TGTCATCCCAGGGCTCCCTCTGG - Intronic
1047528921 8:125657644-125657666 CATGCACCCAGCACTCCCTCTGG - Intergenic
1047700541 8:127445340-127445362 TCATCACCCAGGACTGCCTCAGG + Intergenic
1048717693 8:137286547-137286569 TTTCACCCCAGGGCTCCCTCCGG + Intergenic
1049350490 8:142161890-142161912 TGGCCACCCAGCAGTGCCTCTGG + Intergenic
1049451659 8:142665269-142665291 TGTCCACCCAGGCGTTCCCCTGG + Exonic
1049594744 8:143478134-143478156 GGTCCAGCCAGGACTCCCTGAGG + Intronic
1049604336 8:143522016-143522038 TGTCCACCCAGGTGTGTCTCTGG + Intronic
1051749363 9:20325379-20325401 TGTTCTCCCAGGTTTCCCTCAGG - Intergenic
1053411003 9:37916163-37916185 TGTGCGCCCTGCACTCCCTCTGG + Intronic
1053812065 9:41862713-41862735 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1054618530 9:67324726-67324748 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1060217822 9:121748981-121749003 TCTCAACCCAGGGTTCCCTCAGG - Intronic
1060993144 9:127860433-127860455 TCTCCAGCCAGAACTCCCCCTGG + Intergenic
1061135414 9:128730655-128730677 TGTCCAGCCAGGCCTGCCTGAGG - Exonic
1061418691 9:130461817-130461839 TATCCACCCAGCACTGCCCCGGG + Intronic
1062066974 9:134533878-134533900 TGTCTACCCAGGACCACGTCCGG - Intergenic
1062168980 9:135123887-135123909 TGTCCACCCAGCACTTCCCAAGG - Intergenic
1062381377 9:136288426-136288448 GTCCCACCCTGGACTCCCTCAGG - Intronic
1062451662 9:136618284-136618306 TGGCCCCCCAGGCCTCCCCCAGG - Intergenic
1062586132 9:137250871-137250893 TGGCCAGCCAGGACCCCCTGGGG - Intergenic
1186247978 X:7634544-7634566 TGTTCACCCAGGAGTCATTCAGG - Intergenic
1188346501 X:29072892-29072914 TGCCCTCCCAGGCCTTCCTCGGG - Intronic
1192200109 X:69061188-69061210 AGTCGACCCAGGGCTCCCTTGGG - Intergenic
1192945823 X:75964776-75964798 TGTCACCCCAGGGATCCCTCTGG - Intergenic
1196537674 X:116866858-116866880 TGTTTACCCAGGAGTCACTCAGG + Intergenic
1197142365 X:123131108-123131130 TGTCACCCCCGGGCTCCCTCTGG + Intergenic
1198275688 X:135095804-135095826 TGTCCACCCTTGACCACCTCTGG - Intergenic
1198310829 X:135424929-135424951 TATCCACCCTGGACCACCTCTGG + Intergenic
1198694416 X:139320848-139320870 TGTCCACCCAGAACTCCAGCTGG - Intergenic
1201424220 Y:13831395-13831417 TGCCCACCCAGAACTCACGCTGG - Intergenic
1201707415 Y:16952330-16952352 TGTCTACCCAGCAGTCACTCAGG - Intergenic