ID: 921937279

View in Genome Browser
Species Human (GRCh38)
Location 1:220806814-220806836
Sequence CCATGAGGGCCTAGGCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921937270_921937279 16 Left 921937270 1:220806775-220806797 CCAGAGTGTGGGCCAGGCTGCAG 0: 1
1: 0
2: 4
3: 36
4: 356
Right 921937279 1:220806814-220806836 CCATGAGGGCCTAGGCCACCTGG 0: 1
1: 0
2: 0
3: 23
4: 246
921937272_921937279 4 Left 921937272 1:220806787-220806809 CCAGGCTGCAGCAAGGTTAGCAG 0: 1
1: 0
2: 2
3: 12
4: 190
Right 921937279 1:220806814-220806836 CCATGAGGGCCTAGGCCACCTGG 0: 1
1: 0
2: 0
3: 23
4: 246
921937269_921937279 17 Left 921937269 1:220806774-220806796 CCCAGAGTGTGGGCCAGGCTGCA 0: 1
1: 0
2: 3
3: 28
4: 292
Right 921937279 1:220806814-220806836 CCATGAGGGCCTAGGCCACCTGG 0: 1
1: 0
2: 0
3: 23
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921937279 Original CRISPR CCATGAGGGCCTAGGCCACC TGG Intronic
900206361 1:1433502-1433524 CCATGGGGCCCCAGGCCACCAGG + Intergenic
900361007 1:2289098-2289120 TCCTGAGGGCCTGAGCCACCAGG - Intronic
902292678 1:15445564-15445586 CCGGGAGGGCATAAGCCACCAGG - Intronic
903023909 1:20413487-20413509 CCAGGAGGCCCTTGGCCACAGGG - Intergenic
904344018 1:29856437-29856459 CTAGGAGGGGCTTGGCCACCAGG - Intergenic
904396780 1:30227630-30227652 CTAGGAGGGGCTTGGCCACCAGG - Intergenic
904946990 1:34206666-34206688 CCATGAGCTCCAAGGCCACTAGG - Intronic
906480566 1:46196829-46196851 AGATGAGGCCCTAGGCCGCCTGG - Exonic
908903793 1:68985300-68985322 CCATGAGGGACTGTGCTACCTGG + Intergenic
910177157 1:84443089-84443111 CCCTTGGGGCCTATGCCACCAGG + Intergenic
912580549 1:110717373-110717395 CCATGAGGGCGATGGCCACCAGG - Intergenic
912894927 1:113576369-113576391 CCATGAGGGACTGTGCTACCTGG - Intronic
914361918 1:146943332-146943354 TCATGAGAGCCTGGGTCACCAGG - Exonic
914489707 1:148143623-148143645 TCATGAGAGCCTGGGTCACCAGG + Exonic
917009813 1:170458198-170458220 CCTTGGGTGCCTATGCCACCAGG - Intergenic
919057640 1:192590865-192590887 CTGTGTGTGCCTAGGCCACCTGG + Intergenic
919703887 1:200657980-200658002 CCATGAGAGCTTAGGCAAGCTGG - Intronic
921937279 1:220806814-220806836 CCATGAGGGCCTAGGCCACCTGG + Intronic
922240266 1:223751083-223751105 CCAGGAGAGCCCAGGCCACGTGG + Intronic
922380093 1:225014166-225014188 CCATGAGGGACTATGCCATGAGG - Intronic
924894098 1:248317098-248317120 CCATGAGAGCCTACTCCACCAGG - Intergenic
1065917476 10:30365440-30365462 CCTTCTGGGCCAAGGCCACCCGG + Intronic
1067162211 10:43836675-43836697 CCTTGGGGGCCTATACCACCAGG - Intergenic
1068470025 10:57448705-57448727 CCATGAGGGACTATGCCATGAGG - Intergenic
1069891708 10:71656322-71656344 CCAGGAAGGCCCAGGGCACCTGG - Intronic
1070730592 10:78825267-78825289 TCATGAGGGCAAAGGCCTCCTGG - Intergenic
1070983138 10:80666290-80666312 CCAGCAGTGCCTATGCCACCTGG + Intergenic
1071389227 10:85154226-85154248 AGATGATGGTCTAGGCCACCAGG - Intergenic
1072493748 10:95934532-95934554 CCTTGGGGGCCTACGTCACCAGG - Intronic
1073038046 10:100578106-100578128 CCAGGAAGTCCAAGGCCACCTGG + Intergenic
1074986919 10:118667101-118667123 CCATGAGTGCCTCAGCCTCCCGG - Intergenic
1076675824 10:132147311-132147333 TCATGAGGGCAGGGGCCACCAGG - Intronic
1077331777 11:1987153-1987175 CAACGAGGGCTGAGGCCACCAGG - Intergenic
1081095005 11:38921435-38921457 CCTTGGGTGCCTATGCCACCAGG - Intergenic
1083921384 11:65782828-65782850 CCAAGAGGGCCGAGGGTACCTGG - Intergenic
1084533128 11:69741116-69741138 CTTTGAGGGCCTAGGCTGCCTGG - Intergenic
1085884402 11:80505572-80505594 CCTTGGGTGCCTATGCCACCAGG + Intergenic
1091296930 11:134480473-134480495 TCATGGAGGCCCAGGCCACCTGG - Intergenic
1091320381 11:134645341-134645363 CTACAAGGGCCAAGGCCACCTGG - Intergenic
1202814758 11_KI270721v1_random:42329-42351 CAACGAGGGCTGAGGCCACCAGG - Intergenic
1092304299 12:7283482-7283504 CCATGAGGGACTGTGCCACGAGG + Intergenic
1092629007 12:10358741-10358763 CCATGAGGGACTGTGCTACCTGG - Intergenic
1093722568 12:22461916-22461938 CCAAGAGGCCCAAGGCCAGCTGG + Intronic
1094733158 12:33200986-33201008 CCTTGGGTGCCTATGCCACCAGG - Intergenic
1094853864 12:34394304-34394326 CCATGAGTGCCTTGGCCCACGGG + Intergenic
1096157528 12:49348887-49348909 CCCAGAGGGCATAGGTCACCAGG - Exonic
1097654494 12:62343607-62343629 CCATGAGGGACTGTGCTACCTGG - Intronic
1097737337 12:63196541-63196563 CCTTGGGTGCCTATGCCACCAGG + Intergenic
1098098137 12:66982555-66982577 CCATGAGGGCCTCTTCCACAGGG - Intergenic
1102168171 12:110822435-110822457 CCAGGAGGGCCTTGGGAACCTGG + Intergenic
1102594342 12:113981133-113981155 CCAAGAGGTCATAGGGCACCAGG + Intergenic
1104765511 12:131327735-131327757 CCATGAGGCCCGAGTCCTCCAGG - Intergenic
1104813813 12:131634317-131634339 CCATGAGGCCCGAGTCCTCCGGG + Intergenic
1104933300 12:132351758-132351780 GCATGAGGACCAAGGCCACGGGG + Intergenic
1106109909 13:26767642-26767664 CCCTGAAGGCCAAGGCCAGCAGG + Intergenic
1106377485 13:29203643-29203665 CCTTGGGTGCCTATGCCACCAGG - Intronic
1106429364 13:29665528-29665550 CCATGAGGGACTGTGTCACCTGG + Intergenic
1108133009 13:47323595-47323617 CCATGAGGGCATAACCCTCCAGG + Intergenic
1109902843 13:68795987-68796009 CCTTGGGTGCCTACGCCACCAGG - Intergenic
1113697419 13:112355827-112355849 TCATGAGGGCCTAGCACACAGGG + Intergenic
1113903884 13:113810636-113810658 CCGGGAGTGCCTAGGCCACTGGG + Intronic
1114080764 14:19200237-19200259 CCAGGAGGGCCTTGGCTTCCTGG + Intergenic
1114298680 14:21354308-21354330 ACATAAGGGACTAGGCCATCTGG - Intronic
1114452697 14:22837398-22837420 CGCTGAAGGCCTGGGCCACCCGG - Intronic
1115339025 14:32272656-32272678 CCATGAGGGACTGTGCTACCTGG + Intergenic
1117329071 14:54694796-54694818 CCTTGAGGACCCAGGCCAGCTGG - Intronic
1121049745 14:90812593-90812615 CCACGAGGGCCTAGGCTTCCGGG + Intronic
1122112554 14:99512582-99512604 CCAGGATGGGCTTGGCCACCTGG + Exonic
1122257630 14:100490584-100490606 CCAGGGTGGCCTAGGCCTCCAGG + Intronic
1122618894 14:103041846-103041868 CCAGGAAGCCCTCGGCCACCAGG + Intronic
1123473578 15:20571734-20571756 CCTTCTGGGCCGAGGCCACCGGG - Intergenic
1123644431 15:22428619-22428641 CCTTCTGGGCCGAGGCCACCGGG + Intergenic
1123665747 15:22608527-22608549 CCTTCTGGGCCGAGGCCACCGGG + Intergenic
1123733876 15:23166745-23166767 CCTTCTGGGCCGAGGCCACCGGG - Intergenic
1123752014 15:23364125-23364147 CCTTCTGGGCCGAGGCCACCAGG - Intronic
1124284379 15:28388050-28388072 CCTTCTGGGCCGAGGCCACCGGG - Intronic
1124298318 15:28523564-28523586 CCTTCTGGGCCGAGGCCACCGGG + Intronic
1124319568 15:28702941-28702963 CCTTCTGGGCCGAGGCCACCGGG + Intronic
1124482943 15:30092490-30092512 CCTTCTGGGCCGAGGCCACCGGG - Intronic
1124489395 15:30144561-30144583 CCTTCTGGGCCGAGGCCACCGGG - Intronic
1124520634 15:30404728-30404750 CCTTCTGGGCCGAGGCCACCGGG + Intronic
1124538023 15:30561491-30561513 CCTTCTGGGCCGAGGCCACCGGG - Intronic
1124544483 15:30613552-30613574 CCTTCTGGGCCGAGGCCACCGGG - Intronic
1124564446 15:30800987-30801009 CCTTCTGGGCCGAGGCCACCGGG - Intergenic
1124754134 15:32393766-32393788 CCTTCTGGGCCGAGGCCACCGGG + Intronic
1124760627 15:32446094-32446116 CCTTCTGGGCCGAGGCCACCGGG + Intronic
1124778005 15:32602968-32602990 CCTTCTGGGCCGAGGCCACCGGG - Intronic
1127772649 15:62243719-62243741 CCTTCTGGGCCAAGGCCACCGGG + Intergenic
1129299789 15:74618935-74618957 CCCTGAGCACCCAGGCCACCAGG + Intronic
1129563155 15:76592841-76592863 CCTTGGGTGCCTATGCCACCAGG + Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1130915165 15:88299358-88299380 CCCTGAGGCCCTTGGCCAACAGG + Intergenic
1131678213 15:94693414-94693436 CCATGAGGGCATTGGTCACTGGG + Intergenic
1132694765 16:1196990-1197012 CCCTGAGTGCCAAGGCCACCAGG - Intronic
1132898399 16:2239590-2239612 TCATGGGGGCCAAGACCACCTGG + Exonic
1132939409 16:2499503-2499525 GCTTCAGGGCCTAGGCCTCCTGG + Intronic
1133031598 16:3013812-3013834 GCTTGAGGGCCTCAGCCACCAGG - Exonic
1133839125 16:9393068-9393090 CCATGAGGGCCTGGAGCTCCAGG + Intergenic
1134249119 16:12562007-12562029 CCATGAGGGGCCAGGCCTCCTGG - Intronic
1137591523 16:49696801-49696823 CCATGCAGGCCTGGGCCTCCAGG + Intronic
1138492486 16:57384463-57384485 CCCTGAGGGGCCAGGCCAGCCGG - Exonic
1138706503 16:58920762-58920784 CCTTGGGTGCCTAGGCAACCAGG - Intergenic
1138843703 16:60539392-60539414 CCTTGAGTGCCTAGACCACAAGG - Intergenic
1139521141 16:67483314-67483336 CCATGGGGGCCAAGCCCATCTGG + Exonic
1140901381 16:79371161-79371183 CCATCAGGGCCCAGCCCTCCAGG - Intergenic
1142108543 16:88319049-88319071 TCAAGAGGGCCTTGGCCACCAGG + Intergenic
1142126807 16:88414511-88414533 CCGTGAGGGCAGAGGCCCCCAGG + Intergenic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142503095 17:344929-344951 GCATGAGGGGAAAGGCCACCTGG + Intronic
1142685731 17:1575951-1575973 CCCTCAGGGCCTGGGCCCCCAGG + Intronic
1146742768 17:35301079-35301101 CCATGAGGGACTGGGCCATGAGG + Intergenic
1146746381 17:35334046-35334068 CCTTGGGGGCCTATGCCACCAGG - Intergenic
1147951129 17:44108647-44108669 CCATGAGGGCCCAGGCAGCCTGG - Intronic
1148690833 17:49525952-49525974 CTATGAGGGCCTCTGACACCAGG - Intergenic
1148873643 17:50673621-50673643 CGATGAGGACCAAGGGCACCTGG + Exonic
1149015327 17:51902445-51902467 CCCTGAGAGACTAGGACACCAGG + Intronic
1151562803 17:74879636-74879658 GCATGAGGTCCCAGGACACCTGG - Intronic
1152083341 17:78202502-78202524 CCACAAGGGCCCGGGCCACCAGG + Exonic
1152154229 17:78622517-78622539 GCATGGGGGCCTATTCCACCTGG - Intergenic
1152633540 17:81421233-81421255 CCGTGTGGGCCAAGGCCAGCCGG - Intronic
1152723595 17:81934652-81934674 CCAGGAGGGCCTGGGCCCCGAGG + Exonic
1152854287 17:82655314-82655336 CCTGGAGGGCCAAGGCCTCCGGG + Exonic
1161343088 19:3753269-3753291 CCATGAGGCCCCAGGCCCCCTGG - Intronic
1161800910 19:6416358-6416380 CCAGCAGGGCCTGGGCCACCTGG + Exonic
1162361788 19:10224785-10224807 CGATGAAGGCCGAGGCCACCTGG + Exonic
1162584214 19:11549354-11549376 GCATGACGGCCTATGGCACCCGG + Exonic
1164781422 19:30896639-30896661 CCATGAAGGCCTTGGACAGCTGG + Intergenic
1165773424 19:38390840-38390862 CCACGAGGCCCTACACCACCTGG + Intronic
1167748955 19:51368511-51368533 CCATGAGGACGTTGGCCACGAGG + Exonic
1168181841 19:54666908-54666930 CCATGAGGTCCCAGGACAGCAGG - Intronic
928076669 2:28271410-28271432 CTGTGAGGGCCCAGGCCACGAGG - Intronic
928488223 2:31754279-31754301 CCATGAGGGACTGTGCTACCCGG + Intergenic
930122338 2:47770138-47770160 CCATGAGGGCTTGGCCCTCCTGG + Intronic
930892677 2:56409424-56409446 CCATGATGGCCTTGGCCACTGGG - Intergenic
931042310 2:58314082-58314104 CCCTGAGGGCTTTTGCCACCTGG + Intergenic
931479185 2:62622395-62622417 CCTTGGGTGCCTATGCCACCAGG - Intergenic
931700796 2:64907506-64907528 CCTTGAGGGACTGCGCCACCTGG - Intergenic
932051764 2:68405219-68405241 CCTCGAGTGCCTATGCCACCAGG + Intergenic
934475636 2:94591617-94591639 CCATGAGGCCTTCTGCCACCTGG + Intronic
937000033 2:118457494-118457516 CCATGAGGGACTATGCCATGAGG - Intergenic
937204328 2:120225845-120225867 CCATAAGGGACCTGGCCACCAGG - Intergenic
937375848 2:121335169-121335191 CCATGATGGCCTAAGCCGCCTGG - Intergenic
938427451 2:131203145-131203167 CCATCAGTGCCTCTGCCACCCGG - Intronic
939687197 2:145213934-145213956 CCATGGGTGCCTACACCACCAGG - Intergenic
945628294 2:212238198-212238220 CCTTGGGTGCCTATGCCACCAGG - Intronic
948121988 2:235537420-235537442 CCATGAGGCCCCACACCACCTGG - Intronic
1168938745 20:1690934-1690956 CCTTGGGTGCCTAGACCACCAGG + Intergenic
1169397093 20:5241840-5241862 CCTTGGGTGCCTACGCCACCAGG - Intergenic
1169421389 20:5463578-5463600 CCATGAGGGACTGTGCTACCTGG - Intergenic
1171403117 20:24892180-24892202 CCAGGAGGGCAAAGGCCAGCGGG + Intergenic
1172212926 20:33213655-33213677 CCATGAGGGCAAAGGCCCTCAGG - Intergenic
1172806491 20:37615536-37615558 CCAAGAGGGACAGGGCCACCAGG + Intergenic
1173701472 20:45075657-45075679 ACATGAGGGCAGAGGACACCGGG + Exonic
1173927466 20:46791682-46791704 CCATGAGGGGATAGGACACAGGG - Intergenic
1175557465 20:59878193-59878215 CCATGTGGCCTCAGGCCACCAGG + Intronic
1177799032 21:25809179-25809201 CCACCAGGGCCTAGGCTAGCTGG + Intergenic
1180049442 21:45324642-45324664 CCCTGGGGGCCTTGGACACCGGG - Intergenic
1180500008 22:15922448-15922470 CCAGGAGGGCCTTGGCTTCCTGG - Intergenic
1180866127 22:19120981-19121003 CGGTCAGGGCCTTGGCCACCAGG + Intronic
1181306331 22:21919262-21919284 CCAGGAGGGTGTAGGCCACCAGG + Intergenic
1181911993 22:26245493-26245515 CCATGGGGACTTGGGCCACCTGG + Intronic
950517649 3:13478171-13478193 CCATGAAAGCCTGGGCCAACCGG - Intergenic
950696332 3:14703854-14703876 CTCTGAGGGCCCAGGCCACTGGG + Intronic
953344049 3:42160260-42160282 CCATGCAGGCCTGGGCCCCCAGG - Intronic
954529329 3:51304589-51304611 ACTTGTGGGCCTACGCCACCAGG - Intronic
954646500 3:52134940-52134962 CCATCAGGCCCTTGGCCACCAGG + Intronic
954950483 3:54468451-54468473 CCTCGGGTGCCTAGGCCACCAGG + Intronic
956005771 3:64776808-64776830 CCTTGCGTGCCTACGCCACCAGG + Intergenic
956970982 3:74524863-74524885 CCATGAGCACCTAAGCCACAGGG - Intergenic
957776449 3:84761029-84761051 CCTCGGGGGCCTATGCCACCAGG + Intergenic
958892396 3:99795540-99795562 CCTTGAGGACCAAGGGCACCAGG - Exonic
961504513 3:127361254-127361276 CCATGAGAGCCAGGGCCATCTGG + Intergenic
961561647 3:127734333-127734355 CCATGAGGCGCCAGGGCACCTGG + Intronic
961860985 3:129916736-129916758 CCATGGGGGGCACGGCCACCAGG - Intergenic
962892181 3:139681559-139681581 CCTTGAGGGCCTTGCACACCAGG - Intergenic
967562709 3:190935144-190935166 CCTTGGGTGCCTATGCCACCAGG - Intergenic
967715525 3:192757986-192758008 CCATGAGGGACTGTGCTACCTGG + Intronic
969176441 4:5402567-5402589 CCATGAGTTCCTCGGCCACAGGG - Intronic
969909233 4:10428195-10428217 CCTTGGGTGCCTATGCCACCAGG - Intergenic
970719315 4:18967938-18967960 CCATGAGGGCTTAGCCCTCATGG - Intergenic
972743324 4:41909635-41909657 CCTTGGGTGCCTATGCCACCAGG - Intergenic
976439235 4:85054819-85054841 CCTTGGGTGCCTATGCCACCAGG + Intergenic
976669457 4:87636222-87636244 CCTCGAGTGCCTAGGCCACCAGG + Intergenic
981749812 4:148082583-148082605 CCTTGGGTGCCTATGCCACCAGG + Intronic
984493627 4:180468419-180468441 CCTTGAGTGCCTATACCACCAGG + Intergenic
984690757 4:182723179-182723201 ACATGAGGTCCAAAGCCACCAGG + Intronic
985628051 5:1000292-1000314 CCTGGAGGGACCAGGCCACCAGG - Intergenic
987864701 5:23524237-23524259 CCATGGAGGCCTAGACCAGCAGG + Intronic
990565779 5:57027150-57027172 CCCTCAGGGTCTAGGCAACCTGG + Intergenic
990810350 5:59715667-59715689 CCATGTGGGGCTAGGCCATGTGG + Intronic
993911503 5:93690074-93690096 CCTAGAGTGCCTATGCCACCAGG + Intronic
1001365431 5:171133645-171133667 CCATGTGGGCATAGGCTACCCGG + Intronic
1002299479 5:178249160-178249182 CCAGGAGAGCCTGGGCCAGCAGG - Exonic
1002673485 5:180889717-180889739 CCCTGGGTGCCTACGCCACCAGG + Intergenic
1006295780 6:33169426-33169448 CCAGGAGAGCCAGGGCCACCAGG - Exonic
1008595716 6:53039815-53039837 CCATGAGGTCCTCCGCCACTAGG - Intronic
1009570121 6:65374342-65374364 CCATGAGGGACTGGGCTATCTGG + Intronic
1009933709 6:70207167-70207189 CCCTGTGGGCCTGGGGCACCTGG - Exonic
1009945412 6:70336748-70336770 CCTTGGGTGCCTACGCCACCAGG - Intergenic
1010459421 6:76097566-76097588 CCTTGGGTGCCTATGCCACCAGG + Intergenic
1011298974 6:85854023-85854045 CCTTGGGTGCCTATGCCACCAGG - Intergenic
1011387737 6:86815752-86815774 CCTTGGGTGCCTATGCCACCAGG - Intergenic
1013980362 6:116121349-116121371 CCAGGAGGGCCTTGGGGACCTGG + Exonic
1015163076 6:130174372-130174394 CCATGAGGGACTGTGCTACCTGG - Intronic
1015182819 6:130379069-130379091 CCATGAGGGCAGAGGCCTCGTGG + Intronic
1015883328 6:137891530-137891552 CCTTGAGTGCCTATACCACCAGG - Intergenic
1017822893 6:158061624-158061646 CTCTGAGGGCCTGGGGCACCTGG + Intronic
1018108663 6:160513707-160513729 CCTTGGGTGCCTATGCCACCAGG + Intergenic
1018355307 6:163008621-163008643 CTACGAGAGCCTGGGCCACCAGG + Intronic
1019449903 7:1092049-1092071 CAATGAGGGAGTCGGCCACCAGG - Exonic
1020129579 7:5552188-5552210 CCATCAGGGCGTTGCCCACCTGG + Intronic
1020339048 7:7089488-7089510 CCATAAGGGACTATGCCACGTGG - Intergenic
1020358326 7:7301427-7301449 CCTTGGGTGCCTATGCCACCAGG - Intergenic
1020367280 7:7394054-7394076 CCTTGGGTGCCTACGCCACCAGG - Intronic
1021130017 7:16900308-16900330 CCTTGTGAGCCCAGGCCACCAGG - Intergenic
1021749409 7:23780048-23780070 CCATGAGGGACTGTGCCATCAGG - Intronic
1021771431 7:24005757-24005779 CCATGAGGGCAGAGACCTCCTGG + Intergenic
1021877314 7:25060684-25060706 CCATGAAGGCTCAGGCCACCAGG + Intergenic
1022058897 7:26770575-26770597 CCTTGGGTGCCTATGCCACCAGG - Intronic
1022481323 7:30744975-30744997 CCATGAGGGCCTCTGCCAGGTGG - Intronic
1024047166 7:45592687-45592709 CAAAGAGGGCCTAGGCCGCCCGG - Intronic
1025777668 7:64573364-64573386 CCATTAGGGCCAAGGCCAAATGG + Intergenic
1026847174 7:73704786-73704808 CCATGAGTGCCAAGGCCTCGGGG - Intronic
1026963728 7:74426105-74426127 CCCTGAGGGCTGGGGCCACCAGG - Intergenic
1028506273 7:91574033-91574055 CCAAGATGGCCTAGTCAACCAGG + Intergenic
1034140186 7:148808191-148808213 CCATGGGGGGTGAGGCCACCGGG + Intronic
1036499977 8:9304765-9304787 CCATGAGGGGCTATGACAGCAGG + Intergenic
1036507359 8:9367669-9367691 CCATCAGGGCCTTGGGCACTGGG + Intergenic
1036712830 8:11092890-11092912 CCATGAGGGCCAAGGAGACCTGG + Intronic
1039284512 8:36026384-36026406 CCACCAGTGCCTATGCCACCAGG + Intergenic
1041836587 8:62223445-62223467 CCTTGGGTGCCTATGCCACCAGG + Intergenic
1046154381 8:110268082-110268104 CCATGAGGGCCTTTGCCACTGGG - Intergenic
1048310998 8:133322542-133322564 CCATGAGGGGCTGGGACACGTGG - Intergenic
1048861200 8:138725403-138725425 CCAGGGGGGCCTGGGACACCAGG + Exonic
1049015030 8:139914138-139914160 GAATGAGGGCCGAGGCCATCAGG + Intronic
1049606613 8:143532582-143532604 CGATGGAGGCCTTGGCCACCCGG + Intronic
1049665783 8:143841832-143841854 CCATGAGGGGGGAGCCCACCCGG + Intergenic
1051026687 9:12621150-12621172 TCCTCAGGGCCTAGGCCAACAGG + Intergenic
1051745900 9:20294210-20294232 CCATGGGAGACTAGGCCAGCAGG - Intergenic
1051863436 9:21651972-21651994 CCTTGGGTGCCTATGCCACCAGG - Intergenic
1051982863 9:23045719-23045741 CCTTGTGAGCCTATGCCACCAGG + Intergenic
1052854426 9:33398300-33398322 CCATGAGGCCTTCTGCCACCTGG - Intronic
1053682431 9:40494461-40494483 CCATGAGGCCTTCTGCCACCTGG - Intergenic
1053932414 9:43122787-43122809 CCATGAGGCCTTCTGCCACCTGG - Intergenic
1054281283 9:63130468-63130490 CCATGAGGCCTTCTGCCACCTGG + Intergenic
1054295530 9:63329961-63329983 CCATGAGGCCTTCTGCCACCTGG - Intergenic
1054393550 9:64634465-64634487 CCATGAGGCCTTCTGCCACCTGG - Intergenic
1054428199 9:65139679-65139701 CCATGAGGCCTTCTGCCACCTGG - Intergenic
1054502181 9:65881865-65881887 CCATGAGGCCTTCTGCCACCTGG + Intronic
1057829738 9:98397268-98397290 CCAGGATGTCCAAGGCCACCTGG - Intronic
1060547015 9:124467848-124467870 GCGGGAGGGCCCAGGCCACCAGG - Intronic
1062193982 9:135263251-135263273 CCAAGAGCACCTGGGCCACCAGG + Intergenic
1062265797 9:135685935-135685957 CAAGGAGCGCCAAGGCCACCCGG - Intergenic
1062374908 9:136257685-136257707 CTCTGAGAGCCAAGGCCACCTGG + Intergenic
1203758797 EBV:740-762 CCAAGAGTACCTAGGCCCCCTGG - Intergenic
1187660784 X:21544818-21544840 CCATGAGGGACTATGCCATGAGG + Intronic
1188201642 X:27299540-27299562 CCTTGGGTGCCTATGCCACCAGG + Intergenic
1191099022 X:56705076-56705098 CCTTGAGTTCCTATGCCACCAGG - Intergenic
1192009208 X:67250237-67250259 CCTTGGGTGCCTACGCCACCAGG + Intergenic
1193081631 X:77412160-77412182 CCTTGGGTGCCTATGCCACCAGG - Intergenic
1193389128 X:80906123-80906145 CCTTGGGTGCCTATGCCACCAGG + Intergenic
1193646729 X:84079335-84079357 CCTTGAGTGCCTAAACCACCAGG + Intronic
1194515376 X:94845311-94845333 CCTTGGGTGCCTATGCCACCAGG - Intergenic
1195615562 X:106909402-106909424 CAGTGAGAGCCTAGGCCAGCGGG + Intronic
1195754998 X:108191506-108191528 CCCTGAGGCCCTAGGGCTCCTGG + Exonic
1195790581 X:108580539-108580561 CCAGGAGGCCCTCGGTCACCAGG - Exonic
1197718601 X:129728500-129728522 TCATGAGGGTCGAGCCCACCTGG + Intergenic
1199718648 X:150525801-150525823 CCATGAGGCCCTGGGGCAGCTGG - Intergenic
1200388542 X:155918428-155918450 CCTTGGGTGCCTATGCCACCAGG - Intronic
1201563634 Y:15343986-15344008 CCTTGAGTGCCTATGCCACTGGG - Intergenic