ID: 921940578

View in Genome Browser
Species Human (GRCh38)
Location 1:220834616-220834638
Sequence GGGCTGGCCAAGAAGTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921940578_921940585 11 Left 921940578 1:220834616-220834638 CCTTGAGACTTCTTGGCCAGCCC No data
Right 921940585 1:220834650-220834672 TGAGCCAATTAGTCTCCTGTTGG No data
921940578_921940587 25 Left 921940578 1:220834616-220834638 CCTTGAGACTTCTTGGCCAGCCC No data
Right 921940587 1:220834664-220834686 TCCTGTTGGTTTTGTTTCTCTGG 0: 11
1: 130
2: 604
3: 1220
4: 2101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921940578 Original CRISPR GGGCTGGCCAAGAAGTCTCA AGG (reversed) Intergenic
No off target data available for this crispr