ID: 921942195

View in Genome Browser
Species Human (GRCh38)
Location 1:220853730-220853752
Sequence GTTCAGCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921942195_921942197 5 Left 921942195 1:220853730-220853752 CCTACAGCATGGTGCTGCTGAAC No data
Right 921942197 1:220853758-220853780 CTCTGATTTAGCATCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921942195 Original CRISPR GTTCAGCAGCACCATGCTGT AGG (reversed) Intergenic