ID: 921942197

View in Genome Browser
Species Human (GRCh38)
Location 1:220853758-220853780
Sequence CTCTGATTTAGCATCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921942195_921942197 5 Left 921942195 1:220853730-220853752 CCTACAGCATGGTGCTGCTGAAC No data
Right 921942197 1:220853758-220853780 CTCTGATTTAGCATCTCCTTTGG No data
921942193_921942197 29 Left 921942193 1:220853706-220853728 CCAGGTCAGCTATGGAACAAATC No data
Right 921942197 1:220853758-220853780 CTCTGATTTAGCATCTCCTTTGG No data
921942192_921942197 30 Left 921942192 1:220853705-220853727 CCCAGGTCAGCTATGGAACAAAT No data
Right 921942197 1:220853758-220853780 CTCTGATTTAGCATCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921942197 Original CRISPR CTCTGATTTAGCATCTCCTT TGG Intergenic