ID: 921945010

View in Genome Browser
Species Human (GRCh38)
Location 1:220880151-220880173
Sequence GGTGGCGCCCTCCGAAGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921945003_921945010 -3 Left 921945003 1:220880131-220880153 CCGCTTCGACCCACCCCAGTGGT 0: 1
1: 0
2: 1
3: 13
4: 119
Right 921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 94
921944997_921945010 23 Left 921944997 1:220880105-220880127 CCTCTTTCCAAGCGGCGGCCAGA 0: 1
1: 0
2: 1
3: 9
4: 74
Right 921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 94
921945001_921945010 -2 Left 921945001 1:220880130-220880152 CCCGCTTCGACCCACCCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 147
Right 921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 94
921944995_921945010 30 Left 921944995 1:220880098-220880120 CCGCACGCCTCTTTCCAAGCGGC 0: 1
1: 0
2: 2
3: 9
4: 75
Right 921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 94
921944998_921945010 16 Left 921944998 1:220880112-220880134 CCAAGCGGCGGCCAGATCCCCGC 0: 1
1: 0
2: 1
3: 4
4: 86
Right 921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 94
921944999_921945010 5 Left 921944999 1:220880123-220880145 CCAGATCCCCGCTTCGACCCACC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 94
921945000_921945010 -1 Left 921945000 1:220880129-220880151 CCCCGCTTCGACCCACCCCAGTG 0: 1
1: 0
2: 0
3: 13
4: 119
Right 921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921945010 Original CRISPR GGTGGCGCCCTCCGAAGTCC CGG Exonic
900671790 1:3858878-3858900 GCTGGCACTCTCCGAGGTCCTGG + Intronic
901080302 1:6580248-6580270 GCTGCCGCCCTCCGCCGTCCGGG + Intronic
901207533 1:7505539-7505561 GGTGGCCTCATCTGAAGTCCAGG - Intronic
901491765 1:9600392-9600414 GGTGGTGCACTCCTAAGCCCTGG - Intronic
908739098 1:67308421-67308443 GGGGGGGCCTTCCGTAGTCCCGG + Intronic
912628135 1:111223072-111223094 GGAGGCTCCCTCGGGAGTCCAGG + Intronic
921073787 1:211683880-211683902 GGTGGTGCCCTCCTATGTCGGGG - Intergenic
921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG + Exonic
922617132 1:226967526-226967548 GGTGGAGCACCACGAAGTCCTGG + Intronic
923463839 1:234231348-234231370 GGCAGCGCCCTGCGAAGTGCAGG + Intronic
1066469867 10:35687953-35687975 GGTGGAGCCCTCCAAAGGACAGG + Intergenic
1067448030 10:46364826-46364848 GGTGGTGCCCGGGGAAGTCCAGG - Intergenic
1067589350 10:47495935-47495957 GGTGGTGCCCGGGGAAGTCCAGG + Intergenic
1067636474 10:48004014-48004036 GGTGGTGCCCGGGGAAGTCCAGG + Intergenic
1067787773 10:49263069-49263091 TCTGGTGCCCTCTGAAGTCCTGG - Intergenic
1067877015 10:50016311-50016333 GGTGGTGCCCAGGGAAGTCCAGG - Intergenic
1070133023 10:73667998-73668020 GGTGGTGCCCGGGGAAGTCCAGG + Intergenic
1070834360 10:79438585-79438607 AGTGGTGCCCTCTGGAGTCCTGG - Intronic
1071545015 10:86522163-86522185 GGCGGCGGCCTCCGCAGGCCCGG - Intergenic
1071599528 10:86951418-86951440 GGTGGGGCCCTCCAGAGTGCAGG + Intronic
1071617327 10:87087260-87087282 GGTGGTACCCTCCAAATTCCAGG - Intronic
1073578002 10:104641270-104641292 TGTGGCGCCCGCCGAGGTGCGGG - Exonic
1083404373 11:62446478-62446500 GGTTGTGCCCTGGGAAGTCCCGG - Intronic
1086099735 11:83086576-83086598 GGTGGCGCAGTGCGTAGTCCTGG - Intergenic
1091701945 12:2669178-2669200 GCTGGGGCCCTGCGATGTCCTGG - Intronic
1092102665 12:5899089-5899111 GTTGGCGGACTCCGGAGTCCTGG - Intronic
1102240114 12:111320066-111320088 GATGGCGTCCTCCGAGGTGCTGG - Exonic
1102469993 12:113154434-113154456 GGTGGCGCGCTTCGACGGCCTGG + Exonic
1105031509 12:132887460-132887482 GGGGGCGCCCGCCGGCGTCCAGG - Intronic
1117377595 14:55129826-55129848 GGAGGCGCCCTATGCAGTCCTGG - Intronic
1118084423 14:62398813-62398835 GGTGACACCCTCAGAGGTCCTGG - Intergenic
1119438485 14:74612677-74612699 GGGGGCGCCCTCCGCAGGGCCGG + Intergenic
1127173591 15:56329022-56329044 GGTGGTGGCCTCAGAAGTGCTGG + Intronic
1129651901 15:77496988-77497010 GCTGGCGCCCTCTGCTGTCCCGG + Intergenic
1130466817 15:84196643-84196665 GGTGGCCCCCTCCCACGTCTGGG - Intergenic
1130497447 15:84476893-84476915 GGTGGCCCCCTCCCACGTCTGGG + Intergenic
1132868706 16:2106063-2106085 GGGGGCGCCCTCCCACGGCCTGG + Intronic
1133312875 16:4861806-4861828 GGTGGCGCTCGCCGTAATCCCGG + Intronic
1133434980 16:5771432-5771454 GGAGTCTCCCTCCGTAGTCCAGG + Intergenic
1134522879 16:14926596-14926618 GGGGGCGCCCTCCCACGGCCTGG - Intronic
1134549748 16:15133462-15133484 GGGGGCGCCCTCCCACGGCCTGG + Intronic
1134710547 16:16325247-16325269 GGGGGCGCCCTCCCACGGCCTGG - Intergenic
1134718717 16:16369535-16369557 GGGGGCGCCCTCCCACGGCCTGG - Intergenic
1134949055 16:18343398-18343420 GGGGGCGCCCTCCCACGGCCTGG + Intergenic
1134956038 16:18382624-18382646 GGGGGCGCCCTCCCACGGCCTGG + Intergenic
1135757593 16:25111102-25111124 GGTGGCGGCCGCCTTAGTCCTGG - Intergenic
1136753909 16:32666981-32667003 GCAGGGGCCCTCTGAAGTCCAGG + Intergenic
1136814204 16:33203384-33203406 GCAGGGGCCCTCTGAAGTCCAGG - Intronic
1136820680 16:33313464-33313486 GCAGGGGCCCTCTGAAGTCCAGG - Intergenic
1136827243 16:33370003-33370025 GCAGGGGCCCTCTGAAGTCCAGG - Intergenic
1136832309 16:33468774-33468796 GCAGGGGCCCTCTGAAGTCCAGG - Intergenic
1139534883 16:67565537-67565559 GGTGGCACACGCCGTAGTCCTGG + Intronic
1202992780 16_KI270728v1_random:26358-26380 GCAGGGGCCCTCTGAAGTCCAGG - Intergenic
1142560272 17:805345-805367 GGTGGAGCCCACCGAGGACCTGG + Intronic
1145733414 17:27211128-27211150 GGTGGCTCCACCCGTAGTCCCGG - Intergenic
1160204604 18:76822615-76822637 GGGGCCGCCCCCCGAAGCCCAGG + Intronic
1161072695 19:2270525-2270547 GGTGGCGCACTCCGACAGCCCGG + Intronic
1161102221 19:2426843-2426865 GGTGCCACCCTCCTAAGCCCCGG + Exonic
1161550579 19:4910107-4910129 GGGGGCCCCCTCTGTAGTCCCGG + Intronic
1163934746 19:20432649-20432671 GGTGGCGGACTCTGGAGTCCAGG + Intergenic
926095780 2:10080085-10080107 GGTGGCGGCGGCCGAGGTCCCGG - Exonic
931809291 2:65838931-65838953 AGTGGCACCCTACCAAGTCCTGG - Intergenic
945410431 2:209500086-209500108 AGTGGCTCCTTCAGAAGTCCAGG - Intronic
946003071 2:216499084-216499106 GGCCGCGCGCTCCGAAGGCCCGG - Intronic
947542932 2:230991043-230991065 GGCGGCGCGCTTGGAAGTCCAGG - Intergenic
1175750506 20:61493839-61493861 GGTGGCCCCCACCCCAGTCCTGG + Intronic
1176128973 20:63488242-63488264 GGTGCCGCGCTCCGAACCCCGGG - Exonic
1180734886 22:18008802-18008824 GGTGGCTCCACCCGTAGTCCCGG + Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181044217 22:20207002-20207024 GGTGGCCCTCTCAGAAGCCCAGG - Intergenic
949414149 3:3798922-3798944 GGGGGCGTCCTCCGCAGACCTGG - Intronic
950496407 3:13336792-13336814 GGTGCCGCCCTCGGAGGTCCAGG + Exonic
953975091 3:47376457-47376479 GGTGGTCCCCTCCCCAGTCCAGG + Intergenic
961713575 3:128844719-128844741 GGAGGCGCCCTCCCCAGGCCTGG - Intergenic
961714721 3:128850383-128850405 GGAGGCGCCCTCTGATGTCCAGG + Intergenic
972032524 4:34479011-34479033 GGTGGCTGTCTCCGCAGTCCTGG + Intergenic
986224575 5:5801021-5801043 GCTGGCGTCCTCCCATGTCCTGG + Intergenic
998286905 5:140871139-140871161 CGCGGCGCCCGCCAAAGTCCGGG - Exonic
1012451611 6:99358064-99358086 TGTGGGGACCTCCGCAGTCCAGG + Intergenic
1014101639 6:117517724-117517746 GCTTGCACCCTCTGAAGTCCTGG + Intronic
1019365165 7:629384-629406 GGTGGCGCCCTCGGAGGCCGTGG - Intronic
1019365182 7:629440-629462 GGTGGCGCCCTCGGAGGCCGTGG - Intronic
1019365251 7:629664-629686 GGTGGCGCCCTCGGAGGCCGTGG - Intronic
1019365268 7:629720-629742 GGTGGCGCCCTCGGAGGCCGTGG - Intronic
1034841630 7:154403179-154403201 GGTGGCGACCTGCTGAGTCCAGG - Intronic
1035108402 7:156460736-156460758 CGTGGGGCCCTCTGAGGTCCCGG + Intergenic
1038845181 8:31222394-31222416 GGTGGCTCCCTACAAAGTACAGG - Intergenic
1042746227 8:72109458-72109480 GGTGGGGTCTTCTGAAGTCCTGG - Intronic
1049218433 8:141418085-141418107 GGTGGCGCCCTCCGGAGGGCTGG + Intronic
1049610833 8:143553992-143554014 GGTGGCGGCCTCCAGAGTGCAGG - Intronic
1052872791 9:33524192-33524214 GAGGGCGCCTTCCGGAGTCCGGG + Intergenic
1053135385 9:35647296-35647318 GGTGGGGTCCTCAGAGGTCCAGG + Intergenic
1057509261 9:95663998-95664020 GGAGGAGCCCTGGGAAGTCCAGG - Intergenic
1062497270 9:136837725-136837747 CGTGGAGCGCTCCGAAATCCAGG - Intronic
1062498990 9:136844312-136844334 GGCGGCCCCCTCCGCAGCCCAGG - Intronic
1185520429 X:734524-734546 GGTGGCGGCCTCGGGGGTCCTGG - Intergenic
1186346852 X:8702706-8702728 GGTGTCGTCCTTGGAAGTCCTGG - Intronic
1200161789 X:154013365-154013387 GCTGGCGGCCTCCGAATGCCCGG + Exonic