ID: 921945641

View in Genome Browser
Species Human (GRCh38)
Location 1:220884258-220884280
Sequence AAGGACAAGGACAAGGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 826
Summary {0: 1, 1: 0, 2: 12, 3: 78, 4: 735}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921945626_921945641 26 Left 921945626 1:220884209-220884231 CCAGAACCGGCGGATGAAGTGGC 0: 1
1: 0
2: 6
3: 16
4: 51
Right 921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG 0: 1
1: 0
2: 12
3: 78
4: 735
921945628_921945641 20 Left 921945628 1:220884215-220884237 CCGGCGGATGAAGTGGCGGCACT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG 0: 1
1: 0
2: 12
3: 78
4: 735
921945632_921945641 -3 Left 921945632 1:220884238-220884260 CCAAGGAGGCCCAGGCCCAAAAG 0: 1
1: 0
2: 4
3: 24
4: 261
Right 921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG 0: 1
1: 0
2: 12
3: 78
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921945641 Original CRISPR AAGGACAAGGACAAGGAGGC TGG Exonic
900107010 1:986593-986615 GAGGACGAGGACACGGAGCCTGG - Intergenic
900177002 1:1295395-1295417 CAGGGCAGGGCCAAGGAGGCTGG - Intronic
900349808 1:2228911-2228933 AAGGAGAGCGCCAAGGAGGCGGG + Exonic
900487926 1:2932281-2932303 AAGGACAAGGACAGGGACCGGGG + Intergenic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901192635 1:7421754-7421776 AAGGGAAAGACCAAGGAGGCAGG + Intronic
901464750 1:9413884-9413906 CAGGACCAGGGCCAGGAGGCTGG + Intergenic
902439877 1:16422200-16422222 AAGGACAAGGACACCACGGCTGG + Intronic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903361420 1:22779580-22779602 AATGACAAGGACCAGGAGACTGG - Intronic
903528806 1:24013715-24013737 AAGTTCAAGGTCAAGGTGGCAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904356683 1:29944838-29944860 AAGGACATGGCCATGGAGGGTGG + Intergenic
904455379 1:30644834-30644856 AAAGAAAAGGAAAAGGAGGGAGG - Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905227368 1:36488059-36488081 GAGAACAAAGACATGGAGGCTGG + Intergenic
905435782 1:37954271-37954293 AAGGAGATGGACAAGAAGCCTGG - Intergenic
905566768 1:38971799-38971821 AAAGAAAAGAAAAAGGAGGCCGG + Intergenic
905810733 1:40911194-40911216 GAGGGCAAGGAAAATGAGGCTGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906646579 1:47479393-47479415 GAGGAGAAGGACAAGGCAGCGGG - Intergenic
906679579 1:47716645-47716667 AAGGACGTAAACAAGGAGGCAGG - Intergenic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
907184316 1:52598184-52598206 AAGTACAAGGGCCTGGAGGCAGG - Intergenic
907239386 1:53072648-53072670 AGGGAAAATGTCAAGGAGGCAGG - Intronic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907307415 1:53521046-53521068 AAGGACTGAGAGAAGGAGGCAGG + Intronic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907621282 1:55983437-55983459 AAGGAGAAGGACAAGGCGAAGGG + Intergenic
907821471 1:57974039-57974061 TGGATCAAGGACAAGGAGGCAGG - Intronic
908244739 1:62218945-62218967 AAAGACAAGGACACGTGGGCTGG - Intergenic
908525046 1:64979862-64979884 AAGGACACTGAAAAAGAGGCAGG + Intergenic
908799464 1:67864503-67864525 TAGGACATGGACAAGCAGCCAGG + Intergenic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
910646110 1:89517186-89517208 AGGGACAAGGCCAATGAGGCTGG + Intergenic
910687471 1:89932076-89932098 AAGGACAAGGACAATCATCCTGG - Intronic
911504641 1:98733487-98733509 AAGGAAAAGGACAGAGAGGCAGG - Intronic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
912390609 1:109300148-109300170 AAGCACCAGAACAAGGATGCTGG + Intronic
912791613 1:112657485-112657507 ATGGACAAGGAAAAGGACACTGG - Intronic
913063021 1:115225190-115225212 ACAGACAAGGACAAGGAAGAAGG + Intergenic
913234221 1:116766180-116766202 AGGGAGAAGGACAATGAGCCTGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915109198 1:153552458-153552480 GAGGACAAGGGCAAGGAGCCGGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
915307681 1:154990034-154990056 AAGGACAAGGAAAAGGGAGAAGG + Intronic
916484369 1:165244940-165244962 AGGGACCAGGACAAAAAGGCTGG + Intronic
916489511 1:165289070-165289092 AAGGCACAGGGCAAGGAGGCTGG - Intronic
916579739 1:166096666-166096688 GAGGACAAGAACATTGAGGCAGG - Intronic
916634154 1:166650170-166650192 AAGGACACTGATATGGAGGCTGG - Intergenic
917191642 1:172424685-172424707 AGAGATAAGAACAAGGAGGCCGG - Intronic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919409122 1:197222101-197222123 AAGGACAAGCCCCAGGAGTCAGG + Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919794008 1:201310379-201310401 AACGACAAGGCCAGGCAGGCTGG + Intronic
919800089 1:201348608-201348630 AGGGAAAAGGACAGGGAGCCGGG + Intergenic
919868531 1:201802482-201802504 AAAGAAAAGAAAAAGGAGGCCGG + Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920340400 1:205272036-205272058 CAGGACGAGGACCAGGAGGGTGG - Exonic
920938140 1:210455189-210455211 AAAGACAGGGACAAGAAGACAGG - Intronic
921034219 1:211360974-211360996 AAGGACCAGGAGAAGGAGAGAGG - Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
922212096 1:223494254-223494276 AAGGTCCAGGAGAAGGAGACAGG - Intergenic
922535821 1:226379921-226379943 AAGGGCCAGGTCAAGGAGGAAGG - Exonic
922604444 1:226880798-226880820 AAGGCCAAGGCCAAGGGGACAGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923112467 1:230902875-230902897 AAGGGCGAAGGCAAGGAGGCTGG + Intergenic
923324093 1:232865343-232865365 AAGGACAACAACAAGCACGCAGG + Intergenic
923548738 1:234944189-234944211 AAGGACAAGGAGGAGGAAGGAGG + Intergenic
924146362 1:241079539-241079561 AAGGACAGGGACAGTGAGACAGG + Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924581829 1:245330354-245330376 AAGGCCATGGACAGGCAGGCTGG + Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1063096919 10:2916245-2916267 AAGACCAAGAACCAGGAGGCAGG + Intergenic
1063237141 10:4128763-4128785 GAGGACTAGGAAAACGAGGCTGG + Intergenic
1063503796 10:6579093-6579115 AAAGAAAAGGTCAAAGAGGCCGG + Intronic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1065492921 10:26300534-26300556 AAAGTCAAGGACAAGGTGGCAGG + Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066232421 10:33449294-33449316 AAGGAAATGGCCAAGGAGGTAGG - Intergenic
1066321549 10:34308147-34308169 AGGGACAAGGTCAAAGAGGCTGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1067282381 10:44882110-44882132 AGGGACAAGGGCATGGAGCCTGG - Intergenic
1067292927 10:44957591-44957613 AAGGAAAAGGACAAAAAGGAAGG - Intergenic
1067305469 10:45060087-45060109 AAGTAGGAGGTCAAGGAGGCAGG + Intergenic
1067949174 10:50712689-50712711 AAGGACAAGGTCAAGGAAGGTGG + Intergenic
1068274016 10:54768773-54768795 AAGGACAATGTCAAGGAAGGTGG - Intronic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1069176364 10:65293774-65293796 AAGGAAAGGGAAAATGAGGCAGG - Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069914229 10:71777550-71777572 AAGGGCAAGGAGAAGAAAGCAGG - Intronic
1070215446 10:74374640-74374662 CATGACAATGACAAGCAGGCTGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070429084 10:76318270-76318292 AAGGAAAAAGAAAAGGAGGGAGG - Intronic
1070884489 10:79877701-79877723 AAGGACAAGGTCAAGGAAGGTGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071451533 10:85796106-85796128 AATGACAAGGACAAGGGGAATGG + Intronic
1071508433 10:86246609-86246631 AGGGACCTGGAAAAGGAGGCAGG - Intronic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1072453740 10:95559427-95559449 AAGGAAAAGGCCAACAAGGCGGG + Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073048949 10:100655867-100655889 AAGGAGGAGGACGAGGAGGAAGG - Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074685861 10:115961987-115962009 AAGGAGAGGGGCAAGGGGGCAGG - Intergenic
1075522431 10:123150949-123150971 AAAGACAAAGACTGGGAGGCAGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076304856 10:129458806-129458828 AAGGACAAAGAGAGGGAGACAGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1076843829 10:133059474-133059496 AAAGACATGGAAATGGAGGCCGG - Intergenic
1077078577 11:712533-712555 CAGGACTAGGAAAAGGAGGGAGG + Intronic
1077209179 11:1360531-1360553 AAGGTTGATGACAAGGAGGCTGG - Intergenic
1077302488 11:1853738-1853760 AAGGACAAGGCCAAGGATTCTGG + Intronic
1077302765 11:1854863-1854885 AAGGATGAGGCCAAGGAGGAAGG - Intronic
1079986021 11:27201698-27201720 AAAGTCAAGGCCAAGGAGGAGGG - Intergenic
1080388439 11:31823826-31823848 AAGGACGAGGACTAGGATGCGGG - Intronic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1081481076 11:43489744-43489766 AAGGACAAAGGAAAGGAGGGGGG + Intronic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1082123182 11:48402541-48402563 AAGAACAAGCACAAGGGGTCAGG + Intergenic
1082655966 11:55857320-55857342 AAGGAAAAGGACCTGGAGCCTGG - Intergenic
1082821080 11:57545131-57545153 TAAGAAAGGGACAAGGAGGCCGG - Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083298607 11:61728448-61728470 AAGGACAAGCTCAGGAAGGCAGG - Intronic
1083443281 11:62690735-62690757 AAGGAGAAAGCCAAGGAGTCAGG + Intronic
1083617030 11:64031331-64031353 AAGGTCTAGGACCAGGAGGGTGG - Intronic
1084287299 11:68140589-68140611 AAGGAGGAGCTCAAGGAGGCAGG + Intergenic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084899718 11:72300562-72300584 ACGGGCAGGGGCAAGGAGGCTGG + Intronic
1085011011 11:73141920-73141942 AAGGACCAGGAGGAGGAGGAGGG + Exonic
1085045248 11:73348972-73348994 AGGGACAAAGGCCAGGAGGCTGG + Intronic
1085396940 11:76211165-76211187 CAGGACTAGGACACGAAGGCAGG - Intergenic
1085739884 11:79069697-79069719 AAGGACAAGGCCGAGGGGGCGGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1088818268 11:113435805-113435827 AAAGTAAAGGTCAAGGAGGCTGG - Intronic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1089876393 11:121725780-121725802 AAGGACAAGAAAAAGAAGCCTGG - Intergenic
1090250947 11:125251301-125251323 AAAGACAATTACAAGGAAGCGGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091127447 11:133113407-133113429 AGGGAGAAGAACAAGGAAGCAGG + Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092464676 12:8719910-8719932 AAGGAGACTGACAAGGAGTCTGG + Intronic
1092774203 12:11928268-11928290 TGTGACAAGGACAAGGACGCAGG - Intergenic
1093304797 12:17502048-17502070 AAGTACAAGTACAGGGAAGCTGG - Intergenic
1094171276 12:27494912-27494934 AAGGGCAAGCACTAGAAGGCAGG - Intronic
1094851657 12:34385009-34385031 AGGGGCCAGCACAAGGAGGCAGG - Intergenic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1096465540 12:51846353-51846375 AAAGACAGGGACAATGAGGAAGG + Intergenic
1096499751 12:52057501-52057523 GAGGACAAGGGCAGAGAGGCAGG - Exonic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1097507008 12:60486022-60486044 AAGGACCAGAACAAGGGGGAAGG + Intergenic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098499533 12:71174843-71174865 AAGGAAAAGCACAAGGTGTCAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099345771 12:81497980-81498002 AAAGACACAGACAAGGAGGAGGG + Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1101492105 12:105219103-105219125 GAGGCCAAGGCCAAGGAGGTAGG - Intronic
1101725957 12:107388423-107388445 AAAGAGAAAGACAAGGAAGCAGG - Intronic
1102339779 12:112112507-112112529 TAGGACAGGGAAAAGGAGGGAGG + Intergenic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1103172802 12:118836088-118836110 ATGGAGATGGACAAGAAGGCAGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103603454 12:122069258-122069280 AAAGAAAAGGAAAAAGAGGCTGG - Intergenic
1103626551 12:122224863-122224885 AAGGCCAAGGGCAAGGCGGGAGG + Intronic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1104337902 12:127918035-127918057 AAGGACAAGGGCAGGCAGGAGGG - Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105206366 13:18228904-18228926 CATGACAAAGAAAAGGAGGCCGG + Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106828842 13:33556249-33556271 AAGGAAAAGAAAAGGGAGGCGGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1108040923 13:46338665-46338687 AAGAACAAGACCATGGAGGCAGG + Intergenic
1108281171 13:48863726-48863748 AAGGACAAGTACAGGGAAGAAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1110666159 13:78119493-78119515 GAGGAGGAGGACAAGGAGGGAGG - Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112835917 13:103513788-103513810 GAGGACTAGGACAAGGAACCAGG + Intergenic
1113454722 13:110440115-110440137 AGTGACAAGGACATGGAGGAGGG - Intronic
1113520675 13:110938273-110938295 AAGGGCCAGGTCAAGGAGGAAGG + Intergenic
1113575378 13:111391606-111391628 AAGCACAAGGGCAGTGAGGCTGG - Intergenic
1113733158 13:112657138-112657160 ACAGACAAGGACATGGAGGGTGG + Intronic
1113835868 13:113328168-113328190 AAGGACAGGGACAAGGAGCCTGG - Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114401694 14:22416145-22416167 AAGGACAAGGAGCAGAAGACTGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115300646 14:31881544-31881566 GAGGAGAAGGACAAGGTGACGGG - Intergenic
1116473201 14:45309282-45309304 ATGGAAAAGGACATGGATGCAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117643135 14:57821959-57821981 AGGGACATGGACATGTAGGCAGG - Intronic
1118231361 14:63953337-63953359 AAGGACAGTGACTAGGAGGGTGG + Intronic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1118717905 14:68573363-68573385 AAGTACAGGGACACCGAGGCAGG - Intronic
1119529465 14:75349572-75349594 AAGGAAAAGGAAATGGAGGTTGG - Intergenic
1120645403 14:87068004-87068026 TAGGACAAGGACTAAGAGCCTGG - Intergenic
1120841461 14:89089094-89089116 AAGGTCAAGGTCAAGAAGGAAGG + Intergenic
1120846049 14:89126008-89126030 AAGGAAAAGGACAAGGATGCAGG - Intronic
1120873144 14:89355911-89355933 AAGAACGGGGATAAGGAGGCAGG + Intronic
1121017123 14:90555631-90555653 AAGGGCAAGGAAAAGGACTCTGG - Intronic
1121034460 14:90688901-90688923 AAGGAGAAGGGCTGGGAGGCTGG - Intronic
1121137944 14:91515206-91515228 AAGGACAGGGACAAGGCTGCTGG + Intergenic
1121525145 14:94614337-94614359 CAGGACAGGGACCAGGACGCAGG + Exonic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1121924904 14:97918474-97918496 AGGGAGAAGGACAAGGAAACAGG + Intergenic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1122353788 14:101111894-101111916 AAGGGCAAGGACAAGGAGCGGGG - Intergenic
1122671969 14:103379487-103379509 CAGGACAAGGACAAGGACCCTGG + Intergenic
1122862466 14:104588710-104588732 CAGGACAAGGCCGAGGAGCCGGG - Exonic
1202843435 14_GL000009v2_random:145188-145210 AATGAAAAGAACAAGCAGGCTGG - Intergenic
1202912835 14_GL000194v1_random:135426-135448 AATGAAAAGAACAAGCAGGCCGG - Intergenic
1202879809 14_KI270722v1_random:47254-47276 AATGAAAAGAACAAGCAGGCCGG + Intergenic
1124368109 15:29088258-29088280 AAGGTCATGGGCAAGGGGGCAGG - Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125253713 15:37737481-37737503 AAGGAGAAGGAAAAGCAAGCAGG - Intergenic
1125818981 15:42611595-42611617 CTGGACAAGGACAATGAGGGTGG - Intronic
1127029440 15:54845487-54845509 AAAGAGCAGGAAAAGGAGGCGGG + Intergenic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1129198913 15:73986995-73987017 AGGCAGAAGGGCAAGGAGGCAGG + Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129702360 15:77775177-77775199 AAGGCCATGGCCAAGGAGACTGG - Intronic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130956281 15:88629515-88629537 GAAGAGAATGACAAGGAGGCTGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131030623 15:89183588-89183610 AGGGATCAGGACAAGGATGCTGG - Intronic
1131282078 15:91029878-91029900 AAGTTCTAGGACAAGGAGACTGG + Intergenic
1131456463 15:92586010-92586032 AATGGAAAGGACAAGAAGGCTGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1132080554 15:98861352-98861374 AAAGAGAAGGACTAGGAGGGCGG - Intronic
1132838012 16:1964444-1964466 AAGGCCGAGGATAAGGAGGTAGG - Exonic
1132885353 16:2179889-2179911 AAGGCCAAGGAGCGGGAGGCCGG - Exonic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134082229 16:11332932-11332954 AATGACAAGGACATGGTGGGGGG + Intronic
1134453169 16:14375893-14375915 TAGGACAAGGACATGTAGGAAGG - Intergenic
1134861161 16:17561693-17561715 AAGGTAAAAGACAATGAGGCAGG - Intergenic
1135086406 16:19478113-19478135 AATGAGAAGGCCAGGGAGGCTGG - Intronic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135589495 16:23694982-23695004 AAGGACAGGGAGCGGGAGGCAGG + Intronic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1135663712 16:24318050-24318072 AAGGAAATAAACAAGGAGGCAGG - Intronic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136185409 16:28585616-28585638 AAACACAGGGATAAGGAGGCAGG - Intronic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1137219770 16:46437160-46437182 AAGGAAAAGGAAAAGAAGGAAGG - Intergenic
1137480696 16:48849653-48849675 GAGGACAAGGACAGGGAAGTGGG + Intergenic
1137985133 16:53100701-53100723 AAGGCCAAGGCCAAGGTGGGTGG - Intronic
1138198891 16:55074417-55074439 GAGGACAAGGGCCAGGAGGGTGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138564813 16:57825264-57825286 AGGGACAAAGAGAAGGAGCCTGG - Intronic
1138659856 16:58510511-58510533 AAGGACAGGCACAGAGAGGCTGG - Intronic
1138738580 16:59280672-59280694 AAGTACAAGGCCCAGGAGCCTGG + Intergenic
1139025354 16:62810249-62810271 AAGGAGAGAGAAAAGGAGGCAGG - Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139584611 16:67893696-67893718 AAGGACAAGGACAACCAGGTTGG - Intronic
1140165051 16:72542501-72542523 AAGGACAAGGACACGTGGGTGGG - Intergenic
1140526968 16:75631135-75631157 GAGGACATGTACAAGAAGGCAGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1142567407 17:849622-849644 GAGGACAAGGACGTGGAGGGAGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143634008 17:8154177-8154199 AAAGACAGGGAGATGGAGGCGGG - Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1143953992 17:10654807-10654829 AAGCACAAGGACCAGGTGGAGGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1146007033 17:29166900-29166922 AAAGACAAGGACAAAGATGGCGG - Exonic
1146759025 17:35460190-35460212 AAGGAAAAGGACTAGAAGGCTGG - Intergenic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1147400687 17:40178424-40178446 AAGGGCAAGGAAGAGGAGCCGGG - Intronic
1147584503 17:41646167-41646189 AGGGACAGAGAGAAGGAGGCAGG - Intergenic
1147976548 17:44251232-44251254 AAGGGCAGGGCCAGGGAGGCCGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148790485 17:50170052-50170074 AGGGGCCAGGACTAGGAGGCAGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148978757 17:51552486-51552508 AAGTCCAAGGTCAAGGAGGTAGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151282897 17:73089732-73089754 AAGGACAAGCAAAAGGACCCAGG + Intronic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1151730293 17:75907080-75907102 AAACAAAAGGACAAGGTGGCCGG - Intronic
1151743934 17:76001483-76001505 AAGGCCAAGAACAGGGAGACAGG + Exonic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152624279 17:81381136-81381158 AAGGACCAGGACCTGGGGGCTGG - Intergenic
1152673627 17:81624830-81624852 AAGCACAAAGACCAGGAGGCAGG + Intronic
1152784362 17:82240309-82240331 AGGGAGAAAGACGAGGAGGCAGG + Intronic
1152929278 17:83101676-83101698 CGGGACCAGGACATGGAGGCCGG + Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153776118 18:8455751-8455773 AAGGACAAAGAGAAGAGGGCAGG - Intergenic
1153986336 18:10354130-10354152 AAAGACAAGGACACGGGGACAGG + Intergenic
1155047119 18:22112624-22112646 ATGGGCAAGGCCCAGGAGGCAGG + Intergenic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155593280 18:27452959-27452981 GAGGGCAAGGCCAAGGATGCAGG - Intergenic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156883513 18:42108115-42108137 AAGGAAGAGAACAAGGAGGAGGG + Intergenic
1156964114 18:43069546-43069568 AAGGACAAAAACAAGGAGGTTGG - Intronic
1157495117 18:48151528-48151550 AAAGATAAGGAAACGGAGGCTGG + Intronic
1158011848 18:52737645-52737667 GAAGACAGGGACAAGGAGGGAGG + Intronic
1158279592 18:55808249-55808271 AAGGAGAAGGACTAGGAAGCTGG - Intergenic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1159593361 18:70358723-70358745 AAGGAAGTGGAGAAGGAGGCAGG + Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160824512 19:1073474-1073496 AGAGATAAGGACAAGGAGGTGGG - Intronic
1160833466 19:1113782-1113804 GAGGGCAAGGACAAGGGGCCCGG + Intronic
1161415799 19:4145666-4145688 AGGGAAAAGGCCAAGGAGGAGGG + Intergenic
1161428956 19:4219741-4219763 AAGGAGAAGGACAAGAAGGTGGG + Exonic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161955213 19:7490152-7490174 AAGGAAAAGGACATTGAGGCCGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162873636 19:13604396-13604418 AAAGAGAAAGACAAAGAGGCCGG + Intronic
1163026978 19:14518231-14518253 CCGGACAAGAACAAGGAGCCCGG - Exonic
1163104115 19:15113805-15113827 GAGGACGAGGACGAGGAGGTCGG + Exonic
1163612724 19:18309539-18309561 ATGGCCAAGGACCAGGAGGGGGG + Intronic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1165259967 19:34605024-34605046 AAGGAAGGGGACAAAGAGGCAGG - Intronic
1166170851 19:41026914-41026936 AGGGACAGGGACAGGGATGCTGG + Intergenic
1166303173 19:41923550-41923572 ATGGACAGGGACAAGGAGACAGG + Intronic
1166734171 19:45075001-45075023 AAGGGCAAGGGCCAGGGGGCTGG + Intronic
1166881289 19:45931666-45931688 GAGACCAAGGCCAAGGAGGCTGG - Intergenic
1166882484 19:45937937-45937959 TAGGAGAGAGACAAGGAGGCTGG + Exonic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167637591 19:50664099-50664121 AAAGAAAAGAAAAAGGAGGCTGG - Intronic
1167682149 19:50930345-50930367 AAAGACAAGAACACAGAGGCCGG - Intergenic
1167873689 19:52394133-52394155 AAGAAAAAGGTCAAAGAGGCCGG - Intergenic
1167896842 19:52588575-52588597 AAGGGCAAAGAAAAGGAGCCAGG + Intergenic
1202655427 1_KI270708v1_random:16273-16295 AATGAAAAGAACAAGCAGGCCGG + Intergenic
926246295 2:11124140-11124162 AAGGCCAAAGGCAAGGCGGCCGG + Intergenic
926289490 2:11517189-11517211 AAGGCAAAGGGCAGGGAGGCCGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926570573 2:14525351-14525373 AAGGAAGAGGAGAAGGAGGGAGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926910583 2:17849125-17849147 AGGGAGAAAGACAGGGAGGCAGG + Intergenic
926962899 2:18378301-18378323 AAGGCCAAGGATGAGGAGTCAGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927104453 2:19811390-19811412 AGGGTCAAAGGCAAGGAGGCAGG + Intergenic
927782528 2:25951230-25951252 AAGGACTAGGACATGGAAACAGG + Intronic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927936993 2:27081728-27081750 AAGGACATGGACCTGGGGGCTGG + Intronic
928669386 2:33585256-33585278 GAGGTCATGAACAAGGAGGCGGG - Exonic
928972786 2:37049309-37049331 AGGGACAAGGAAAGGGAGGGAGG + Intronic
930218370 2:48720518-48720540 AAGTGCCAGGACAAGGAGACAGG - Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
931108372 2:59082931-59082953 AAGAACAGGGACAAGGTGGTAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931415847 2:62079541-62079563 GAGGGCAAGGAAAATGAGGCTGG - Intronic
931590775 2:63880829-63880851 AATGACAAGGAAGAGGAGGGAGG - Intronic
931691470 2:64837990-64838012 AAGGGAAAGGAAAAGGAAGCAGG + Intergenic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
932135131 2:69222173-69222195 AAGGAGAATGACAAGAAGACAGG - Intronic
932596290 2:73095712-73095734 AAGGACATGGGCTTGGAGGCTGG - Intronic
933726693 2:85431110-85431132 AAGGAGGAGGAAATGGAGGCTGG + Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934914033 2:98283887-98283909 AAGGAGCTGGACTAGGAGGCAGG - Intronic
935241870 2:101185911-101185933 AAATATGAGGACAAGGAGGCTGG - Intronic
935380272 2:102444732-102444754 AAGGACAAGGCAAAGAAGGTGGG - Intronic
935401242 2:102662661-102662683 AAGGACAAGGAAAGGAAAGCAGG + Intronic
936071635 2:109375265-109375287 GGCGAAAAGGACAAGGAGGCAGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936538881 2:113334080-113334102 TAGGAGAAGGACAAGGGGTCAGG + Intergenic
936902979 2:117504847-117504869 AAGGACACCGAGAAGGTGGCTGG + Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937683550 2:124670105-124670127 AAGGAAAAGGAAAGGAAGGCAGG - Intronic
937763240 2:125630704-125630726 AAGGACGAGGACATCGTGGCTGG - Intergenic
937904287 2:127045386-127045408 AAGGACAAGGGCTGAGAGGCCGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
939185669 2:138857804-138857826 AAGGACAATGACAAGGGTGATGG + Intergenic
940263138 2:151806117-151806139 AAGGTCAAGGACCAGGAAGATGG - Intronic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942450219 2:176104595-176104617 AAGGACAAGGCCACAGAGTCGGG + Intronic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
942589513 2:177527019-177527041 GAGGACAAGGATACTGAGGCAGG - Intronic
942764003 2:179432432-179432454 TAGGAGAGGTACAAGGAGGCTGG - Intergenic
943997554 2:194789430-194789452 GAGGGCTAGGAAAAGGAGGCTGG - Intergenic
945143808 2:206715294-206715316 AAGGCAAAGCCCAAGGAGGCTGG - Intronic
945767220 2:213995952-213995974 AAGGACAAGGAGAAAGAGTGAGG - Intronic
945902077 2:215549963-215549985 GGGGGCTAGGACAAGGAGGCTGG - Intergenic
946080029 2:217109893-217109915 AAGGAGAATGAAGAGGAGGCTGG + Intergenic
946410907 2:219514773-219514795 AAACCCAAGGAGAAGGAGGCAGG + Exonic
946578709 2:221103940-221103962 GAGCACAACGCCAAGGAGGCAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946997125 2:225406210-225406232 AAGGGCATGGATAAGGAGGCTGG - Intronic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
948057911 2:235022932-235022954 AGGGACAAGGTCAAGGAGTGGGG - Intronic
948146233 2:235710221-235710243 CAGGACAAGGGCCAGGAGACAGG + Intronic
948159841 2:235814694-235814716 AAGGACAGGGAAATGGAGGTGGG + Intronic
948209595 2:236183052-236183074 AAGGAGGAAGACAAGGAGGAGGG - Intergenic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948493407 2:238329028-238329050 AAGGAGAAGGCCAAGGAGAATGG + Exonic
948616205 2:239200990-239201012 AGTGAAGAGGACAAGGAGGCAGG - Intronic
948815855 2:240510097-240510119 GAAGACAAGGGCAAGGAGGCAGG - Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1168752340 20:291695-291717 AAGGAGACTGAAAAGGAGGCAGG - Intergenic
1168878261 20:1185554-1185576 AAGGAGAGGGACAGGAAGGCGGG + Intronic
1169052960 20:2595960-2595982 AAGGAAAAGAACAAGGAGACAGG + Intronic
1169080359 20:2794590-2794612 AGGGACAAGGACACGGAGCTTGG - Exonic
1169118014 20:3079087-3079109 AAGAACAAGTAATAGGAGGCTGG - Intergenic
1169637004 20:7703369-7703391 GTGGACAAGGACTAGGGGGCAGG - Intergenic
1170072144 20:12380760-12380782 GAGGGCAAGGCCAAGGATGCAGG + Intergenic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170594042 20:17792271-17792293 AAGGACATGGGAAAGGAGGTGGG + Intergenic
1170843070 20:19939680-19939702 AAGTACAAAGGCCAGGAGGCAGG - Intronic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1171059906 20:21946078-21946100 AAAGAGAAGGACCAGAAGGCAGG + Intergenic
1171069977 20:22059124-22059146 GAGCACAAGGACAAGAAGGGTGG - Intergenic
1171100786 20:22381938-22381960 AGGCAAAAGGACGAGGAGGCTGG - Intergenic
1171336261 20:24388445-24388467 AAGCACACGGACAGGGAGGAGGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172126685 20:32628727-32628749 AAGGAGGGGGACAAGGTGGCGGG + Intergenic
1172135315 20:32682767-32682789 AACGACAAGGCCAGGGCGGCTGG - Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1173530650 20:43766865-43766887 ATGAACAAAGACAGGGAGGCTGG - Intergenic
1173873510 20:46356148-46356170 AAGTAGGAGGACAAGAAGGCAGG + Intronic
1173986160 20:47263188-47263210 AGGGGCAAGGACAAAGGGGCAGG - Intronic
1174602523 20:51736226-51736248 AAGATAAAGGACAAGGAGGGAGG + Intronic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1176632194 21:9150099-9150121 AATGAAAAGAACAAGCAGGCCGG - Intergenic
1176641113 21:9304717-9304739 AATGAAAAGAACAAGCAGGCCGG + Intergenic
1177219955 21:18179665-18179687 AAGTACAAGGAAAAGGAGAGTGG - Intronic
1177532538 21:22379663-22379685 AAAGACAAGAACAAGGACACTGG + Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178529844 21:33366744-33366766 AAGGACAATGCCCAGGAGACAGG - Intergenic
1178553373 21:33562031-33562053 AAATACAAGGGCAAAGAGGCAGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179388872 21:40969387-40969409 AAGCACAAGCACTAGTAGGCAGG + Intergenic
1179681158 21:43022212-43022234 AAGGCCGAGGAGGAGGAGGCTGG - Intronic
1180129961 21:45821001-45821023 ATGGACAAGGACGAGGGGCCGGG - Intronic
1180350134 22:11794099-11794121 AATGAAAAGAACAAGCAGGCCGG + Intergenic
1180374419 22:12077544-12077566 AATGAAAAGAACAAGCAGGCCGG + Intergenic
1180388076 22:12198153-12198175 AATGAAAAGAACAAGCAGGCCGG - Intergenic
1180990108 22:19930588-19930610 AAGGACAGGGACAAGCAGGAGGG + Intronic
1181442612 22:22944578-22944600 GAGGCCAAGGTCAACGAGGCAGG - Intergenic
1181727886 22:24824247-24824269 ATGGGCAAGGACCAGGAGGTGGG + Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182716417 22:32359271-32359293 ATGGACATGGACAAGGAAGGAGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183420744 22:37709964-37709986 AAAGACAAGGGCGAGGAGGAAGG - Intronic
1183686209 22:39362677-39362699 CAGGACAAGGGCAGGAAGGCTGG + Intronic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1183941748 22:41299733-41299755 AAAGAAAAGGGCCAGGAGGCTGG - Intergenic
1184538778 22:45106177-45106199 AAGCAAAAGGACTGGGAGGCGGG + Intergenic
1184686503 22:46098763-46098785 AGGGGCAAGGAGCAGGAGGCCGG - Intronic
1184769481 22:46589162-46589184 AGGGACAAGGACACTGAGCCAGG - Intronic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
951643705 3:24864303-24864325 AAGGAAAAGAACAAGGAACCAGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951846307 3:27088381-27088403 AAGGAAAATGATATGGAGGCTGG + Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952890031 3:38033720-38033742 GAGGACAAGGCCAATGTGGCTGG + Intergenic
953682341 3:45049152-45049174 ATAGACAAGAACAAGGAAGCAGG - Intergenic
953855558 3:46497133-46497155 AAGGAAAAAGGAAAGGAGGCTGG - Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954358529 3:50103657-50103679 AAGGACAACAAAAAGGATGCAGG + Intronic
954382954 3:50229314-50229336 AAGGACAAAGAAAAGGAGGGAGG + Intronic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955314648 3:57926333-57926355 AAGGAAGAGGATAAGGAGGAAGG - Intronic
955338260 3:58104803-58104825 AAGGTAAAGGGCCAGGAGGCTGG + Intronic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
956445629 3:69323042-69323064 AAGGAAAAAGACAATGAGGGAGG + Intronic
956768155 3:72501967-72501989 ATGGACAAGAAAAAGCAGGCTGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957885005 3:86275488-86275510 AAGAACTAAGAAAAGGAGGCAGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959619771 3:108387220-108387242 AACCACCAGGACAAGGAGGCAGG - Intronic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960023871 3:112987194-112987216 AAGTACAAGGACACAGAGGCAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
960911471 3:122653346-122653368 AAGGAAAAGGAAAAAAAGGCAGG + Intergenic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
962038774 3:131683169-131683191 AAGGACAGGGACAAGTAGAGGGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
962847313 3:139283780-139283802 AAGGACAATGACAGAGAGACGGG + Intronic
962878712 3:139555898-139555920 AAGGAGAAGGGCAGGGAGGTAGG + Intergenic
963349285 3:144132987-144133009 ATGAACAAAGAAAAGGAGGCTGG - Intergenic
963733194 3:148991888-148991910 AAGGACGAGGAGACGGAAGCAGG - Intronic
963931462 3:151008340-151008362 AAGAACAAAGTCAAGGAGGCAGG - Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966852010 3:184170363-184170385 AAGGAGAAGGACCCGAAGGCCGG + Exonic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967736201 3:192955184-192955206 GGGGCCAAGGACAAGGAGTCAGG + Intergenic
967852541 3:194093260-194093282 CAGGACAAGGACTAGCCGGCAGG - Intergenic
1202745781 3_GL000221v1_random:100309-100331 AATGAAAAGAACAAGCAGGCCGG - Intergenic
968610683 4:1555592-1555614 AAGGACAGGGACAGGGAGGCCGG - Intergenic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
968935182 4:3606025-3606047 ACAGACAGGGACAAGGAGGGAGG - Intergenic
968938364 4:3625125-3625147 AAGGACAAGGAGAAGCAGTGTGG + Intergenic
969086715 4:4662096-4662118 AGGGACAAGGACATGGTGACTGG + Intergenic
969402001 4:6961839-6961861 AGGCAGGAGGACAAGGAGGCTGG + Intronic
969509989 4:7612298-7612320 AAGGAGAAGGGCATGGAGACAGG + Intronic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
969973607 4:11073995-11074017 AAGGAATAGCACAGGGAGGCTGG - Intergenic
970522932 4:16903670-16903692 ACGGGCAAGCACAAAGAGGCTGG - Intergenic
970637314 4:18022669-18022691 AAGGACTAGGAAAAAGATGCGGG + Intergenic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971483411 4:27134705-27134727 AAAGACAAAGACAAGGAGGCCGG + Intergenic
972323321 4:37992469-37992491 AAGGTCAAGGACTAGAAGTCTGG + Intronic
974803602 4:66851621-66851643 AAGTAAAAGGCCAAGGATGCAGG + Intergenic
975119136 4:70709826-70709848 AAAGACAAGGGCAAGGATGTGGG - Intronic
975705293 4:77105730-77105752 AAGGACTATGAAAATGAGGCTGG + Intergenic
976126569 4:81839416-81839438 AAGGACAAGGTCAAAGAAGAAGG + Intronic
976400273 4:84598899-84598921 AAGGACAAGAACAAGGACAAGGG - Intronic
978224303 4:106315953-106315975 AAGCACAAAGACAAGGGGGATGG + Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
980689893 4:136281524-136281546 AAGGACAAGAAGAAGAAGGTGGG + Intergenic
980909243 4:138978800-138978822 GAGGACTAGGAAAATGAGGCTGG + Intergenic
981379479 4:144056498-144056520 AAGGAGAAGGAAAAGGAAGTTGG + Intergenic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983820311 4:172184809-172184831 AGGTAGAAGGACAAGGGGGCTGG + Intronic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985196286 4:187433263-187433285 AAGGAGAAGAACAAGAGGGCTGG - Intergenic
1202756002 4_GL000008v2_random:62983-63005 AATGAAAAGAACAAGCAGGCCGG + Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
986015007 5:3749883-3749905 ACGGACATGGACAAGCAGGTGGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986386746 5:7242317-7242339 AAGGACAAGCACGACGTGGCAGG + Intergenic
986432232 5:7692682-7692704 GAGGACAAGGCCAAGGGGTCAGG - Intronic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
992057589 5:73007072-73007094 AAGGAAAAGGACAAGAAGCAGGG - Intronic
992616092 5:78547739-78547761 AAGCACCAGGACTAGGAAGCAGG + Intronic
992906917 5:81356058-81356080 AAGCACATGTACAAGGATGCGGG - Intronic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
994520008 5:100821994-100822016 TAAGACAATGACAAGGTGGCAGG + Intronic
994810273 5:104508590-104508612 AGGGACAAAGAGAAGGAGGGAGG + Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
997716888 5:136049182-136049204 AGGGACAAGGACTTGGGGGCAGG + Intronic
997726443 5:136124232-136124254 AATGACAAGGAAAAGGAAGGAGG + Intergenic
998051808 5:139042183-139042205 AAGGACAAGGACAAGGATTCCGG + Intronic
998055101 5:139068353-139068375 GTGGACAAGGACAAGAAGTCTGG + Intronic
998368588 5:141646810-141646832 AAGGACAAGGACAAAGAGAAAGG + Intronic
998869149 5:146535276-146535298 AAACACAAGGCCAAGGTGGCTGG - Intergenic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999048677 5:148497712-148497734 TGAGACAAGGACAAAGAGGCTGG + Intronic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
1000606288 5:163331048-163331070 AAGGATAAGGACAAGAGGGAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1002276856 5:178109432-178109454 GAGGCCAAGGTCAAGGAGACGGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003020615 6:2505766-2505788 AAGGACAAGGAGAGGTAGGTGGG - Intergenic
1003422260 6:5969063-5969085 AAGGACCAGCACAGGGAGGGAGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004375802 6:15089832-15089854 AAGCAGAAGGACAGGGTGGCAGG + Intergenic
1004507419 6:16258385-16258407 AAGGACAAAGACCAGGAAGGAGG + Intronic
1004761488 6:18671539-18671561 AAGGGCAAGGACTCTGAGGCAGG - Intergenic
1004933010 6:20479786-20479808 ATGGACAAGAACAAGAAGGGAGG - Intronic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005044447 6:21628717-21628739 AAGGACAAGGGGAAGGAGAGTGG + Intergenic
1005287868 6:24348161-24348183 AATGACAGTGACAAAGAGGCAGG + Intronic
1005986988 6:30881775-30881797 GAGGTCAAGGCCAAGGAGACAGG - Intronic
1006078728 6:31551588-31551610 AAGGAAAAGAAAAAGGAAGCTGG - Intronic
1006716862 6:36126007-36126029 AAGCAAAATTACAAGGAGGCAGG - Intergenic
1006789020 6:36686613-36686635 AAGGGAAAGGACAAGGGGGAGGG - Exonic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008397775 6:51028642-51028664 AAGGTCAAGGAAAAGAAGGATGG + Intergenic
1009292648 6:61903530-61903552 AAGGATGAAGTCAAGGAGGCTGG + Intronic
1009318375 6:62253484-62253506 AAGGCCAAAGAGGAGGAGGCAGG - Intronic
1009582132 6:65549803-65549825 AAGGACAAGGATAGGCAGACAGG - Intronic
1010198737 6:73264434-73264456 CAGTACAGGAACAAGGAGGCAGG + Intronic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010430773 6:75776008-75776030 AAGGACAAGGACCAGGACACAGG - Intronic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013688939 6:112617159-112617181 GAGGGCAAGGCCAAGGATGCAGG - Intergenic
1014069267 6:117162162-117162184 TAGGACAATGACCATGAGGCAGG - Intergenic
1014794983 6:125714555-125714577 AAGTGAAAGGACAAGAAGGCAGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018577680 6:165276643-165276665 AGGGACAAGGACAATGAAGAGGG - Intergenic
1019133033 6:169891154-169891176 AAGATGAAGGACAAGGAGGGTGG + Intergenic
1019381467 7:726511-726533 CAGGACAAGGCCCAGCAGGCAGG + Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1020179262 7:5908724-5908746 AAGGAGACAGACAATGAGGCTGG - Intronic
1020271823 7:6601247-6601269 AAGGACAAGGACAGGCAGAGTGG - Intronic
1020303672 7:6816131-6816153 AAGGAGACAGACAATGAGGCTGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021808849 7:24382998-24383020 CAGGGCAAGTACAAGGAAGCAGG + Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022764045 7:33390093-33390115 AAGGAAAAGGAAAAGAAGGAAGG - Intronic
1023369859 7:39502407-39502429 GAGGACAAAGAAAAGGTGGCAGG - Intergenic
1023808663 7:43893572-43893594 AAGTAAAAGGACAAAAAGGCTGG + Intronic
1024215675 7:47246256-47246278 AAGTACAGGGAAGAGGAGGCAGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024557303 7:50614559-50614581 AAGCTCAAGGACAAGCAGACAGG - Intronic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1026137607 7:67677297-67677319 TAGGACAAAGAAAAGGAGACTGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026258585 7:68734420-68734442 AAGAAGTAGGACAAGAAGGCCGG - Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027767461 7:82363559-82363581 AAGGATAAAGACAAACAGGCGGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1029372009 7:100156315-100156337 AAGGAAAAAGTCAGGGAGGCAGG - Intronic
1029658148 7:101941034-101941056 AAGGAAAAGGGCAGGGAGCCGGG + Intronic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1031127721 7:117793482-117793504 AAGGACAAAGACCCCGAGGCAGG - Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031891020 7:127293704-127293726 AGGGAAAAGGACAAGATGGCTGG + Intergenic
1031949362 7:127876117-127876139 AAGGACAAAGAGAAGGAGAGGGG - Intronic
1032018516 7:128394097-128394119 AAGGACAAGGAACAGGGGGCTGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032523151 7:132561436-132561458 AAGGAGGAGGACAAGAAGGAGGG - Intronic
1032993067 7:137415165-137415187 AAGGACAAGGAAGGAGAGGCTGG + Intronic
1033351998 7:140569441-140569463 CAGGACAAGGATGGGGAGGCAGG + Intronic
1033879702 7:145865381-145865403 ATGGACTAAGACAAGGATGCCGG - Intergenic
1034329276 7:150268994-150269016 AAGGACAAGGTCGAGGGAGCTGG + Intronic
1034435672 7:151061745-151061767 AAAGAGAAGAACAAGGAGACAGG - Intronic
1034668778 7:152840866-152840888 AAGGACAAGGTCGAGGGAGCTGG - Intronic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035839537 8:2795558-2795580 AAGGAAAAGGAAAAGGATGGAGG + Intergenic
1036064904 8:5369022-5369044 AATCACAAAGACAAGGGGGCAGG - Intergenic
1036152014 8:6307767-6307789 AGGGAGCAGGACACGGAGGCCGG + Intergenic
1036705506 8:11043392-11043414 AAGGAGCAGGAAGAGGAGGCTGG - Intronic
1037801855 8:22040330-22040352 AAGGACCAGGGCAAAGGGGCGGG + Intergenic
1038243964 8:25836871-25836893 AAGGACAAGGACAACTACACAGG - Intergenic
1039087999 8:33799044-33799066 AAGGAGAAGGTCATGGAGGAGGG + Intergenic
1039359917 8:36864920-36864942 AAGGAAAAGGGCAGGGAGGAGGG - Intronic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039895243 8:41712520-41712542 AAGGACAAGGACAACTAGGCTGG + Intronic
1040550339 8:48432571-48432593 AAGGAATAGGGCAAAGAGGCAGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041899913 8:62970667-62970689 AAGGGAATGGACAAGGAGACAGG + Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043746939 8:83886196-83886218 AAGGAGATGGAAAGGGAGGCAGG + Intergenic
1044796192 8:95900596-95900618 AAAGACATGAACAAGGAAGCTGG - Intergenic
1044838138 8:96315361-96315383 AATGCCATGGACATGGAGGCCGG - Intronic
1045196342 8:99934841-99934863 ACGGATAAAGAAAAGGAGGCCGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046625910 8:116576834-116576856 ATGGACTGAGACAAGGAGGCCGG + Intergenic
1046859916 8:119079096-119079118 AAGGAAGAGGACAAGGGGGAAGG - Intronic
1047486834 8:125338961-125338983 AAGGTCAAGGATGAGCAGGCTGG + Intronic
1047509062 8:125502410-125502432 AAGAGCAAAGACATGGAGGCTGG - Intergenic
1047661134 8:127038246-127038268 AAAGAGAAGGACAAGCAGCCAGG - Intergenic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1048922031 8:139239994-139240016 AAGGACAAGGGCTAGGTGGAGGG + Intergenic
1049004487 8:139846058-139846080 GAGGCCAAGGCCAAGGGGGCCGG + Intronic
1049478651 8:142809576-142809598 AAGTACAAGCACAGAGAGGCGGG + Intergenic
1049632394 8:143665695-143665717 AAGGATGAGGACAAGGGGGATGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1052425882 9:28303844-28303866 AAGGAGATAGAAAAGGAGGCAGG + Intronic
1052520472 9:29541536-29541558 AAGGACAGAGAGATGGAGGCAGG - Intergenic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053164964 9:35837793-35837815 AAAGGCAAGGAGATGGAGGCCGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053667449 9:40326086-40326108 AAGGACATATACATGGAGGCTGG + Intronic
1053917029 9:42951189-42951211 AAGGACATATACATGGAGGCTGG + Intergenic
1054378594 9:64466113-64466135 AAGGACATATACATGGAGGCTGG + Intergenic
1054452851 9:65412685-65412707 AAGGACAAGGAGAAGCAGTGTGG - Intergenic
1054455003 9:65425951-65425973 ACAGACAGGGACAAGGAGGGAGG + Intergenic
1054517162 9:66050199-66050221 AAGGACATATACATGGAGGCTGG - Intergenic
1054792043 9:69265536-69265558 AGGGAAAAGGACAAGCAGGAGGG + Intergenic
1055604666 9:77956399-77956421 AAGGACATGAAAAAGGAAGCTGG - Intronic
1055638872 9:78303880-78303902 AAGGACAAGGCCATGGAAACTGG - Intronic
1055782107 9:79831215-79831237 AATGACAAGGCCAAGGAATCTGG - Intergenic
1055903549 9:81267863-81267885 AGAGACAAGAACAAGGAGGTGGG - Intergenic
1056271945 9:84955254-84955276 AAGGACATGGAGAATGAAGCTGG - Intronic
1056320730 9:85432449-85432471 AGGGACAAAGGCAAGGAGGTGGG + Intergenic
1056662340 9:88553464-88553486 AGAGACAAGGAGAAGGAGGGTGG - Intronic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056766959 9:89450258-89450280 AAGGGCAAGACCAAGGATGCAGG + Intronic
1057353052 9:94316373-94316395 AAGGACAGGGACAGTGGGGCAGG + Intergenic
1057654694 9:96941218-96941240 AAGGACAGGGACAGTGGGGCAGG - Intronic
1057682729 9:97205347-97205369 AAGCACAAGCACAAGGGGTCAGG + Intergenic
1058243222 9:102593655-102593677 AAGTACAAGGATTTGGAGGCAGG - Intergenic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1058915118 9:109558081-109558103 AGGCACTAGGGCAAGGAGGCTGG - Intergenic
1058949525 9:109890680-109890702 AAGGACAGGAACCAGGATGCAGG - Intronic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1061205762 9:129162363-129162385 AGGGACCAGGAGAAGGTGGCAGG + Intergenic
1061483393 9:130908432-130908454 AAAGATAAGGACAAGGCGGCAGG - Intronic
1061559569 9:131394014-131394036 GAGGAGGAGGACGAGGAGGCGGG + Intergenic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062242463 9:135547703-135547725 ATGGACCCGGACACGGAGGCAGG - Intronic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1062513981 9:136922886-136922908 GAGGACTAGGACAGGGAGGATGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062727287 9:138082752-138082774 AAGGACAAGCACTAGGTGGAAGG - Intronic
1203687605 Un_GL000214v1:10033-10055 AATGAAAAGAACAAGCAGGCCGG + Intergenic
1203755021 Un_GL000218v1:117725-117747 AATGAAAAGAACAAGCAGGCCGG - Intergenic
1203714402 Un_KI270742v1:130265-130287 AATGAAAAGAACAAGCAGGCCGG - Intergenic
1203536805 Un_KI270743v1:47820-47842 AATGAAAAGAACAAGCAGGCCGG + Intergenic
1203648670 Un_KI270751v1:94020-94042 AATGAAAAGAACAAGCAGGCCGG - Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186324644 X:8465481-8465503 CCGGCCAAGGCCAAGGAGGCAGG + Exonic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1189052927 X:37665336-37665358 AAGGGCAAAGACATGGAGGCAGG - Intronic
1189630236 X:42944621-42944643 AAGGAAAAACACAAGCAGGCTGG + Intergenic
1189913071 X:45830379-45830401 AAGGTGGAGGACAAGAAGGCAGG + Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190278468 X:48914141-48914163 AAGGACCAGGCCAAAGGGGCAGG + Exonic
1190341962 X:49303987-49304009 AGGGGCCAGGACAAGGAGGAAGG + Intronic
1190641020 X:52482761-52482783 AAGGAAGAGGAAAAGGAGGAAGG - Intergenic
1190646652 X:52530104-52530126 AAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1191104407 X:56763729-56763751 AAGGACCAGGACCAGTAGGCTGG - Intergenic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192591413 X:72363049-72363071 AAAGACAAGGGCAGGGTGGCAGG + Intronic
1194280067 X:91940085-91940107 AAGGACAATAACAAGGGGGATGG - Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195973955 X:110505124-110505146 AAGGAAAAGGAAAAGGGGGAAGG - Intergenic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196379689 X:115076374-115076396 AAAGGCAATGACAATGAGGCAGG - Intergenic
1196816535 X:119669491-119669513 AAGGACAAGGTCACAGAGCCAGG - Intronic
1197171944 X:123444367-123444389 AAGGAAAAGAACCAGGAGCCAGG + Intronic
1197454408 X:126660001-126660023 AAGGACAAAGTCAAGGTGGCAGG - Intergenic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1198383379 X:136105077-136105099 AAAGGCAAGGAAAAGGAGGAAGG + Intergenic
1198935190 X:141896806-141896828 GAGGACAAGGAAGAGGAGGAGGG - Intronic
1199811504 X:151354411-151354433 AAGGACAAGTGCATGGAGGCAGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200597540 Y:5163586-5163608 AAGGACAATAACAAGGGGGATGG - Intronic
1200613210 Y:5348569-5348591 AAGGGCAAAGACACAGAGGCAGG - Intronic
1201168645 Y:11235334-11235356 AATGAAAAGGACAAGCAGGTCGG - Intergenic
1201319019 Y:12677012-12677034 AATTACCCGGACAAGGAGGCAGG + Intergenic
1201453010 Y:14136342-14136364 AAAGACAAGGAAAAGGAGAAGGG - Intergenic