ID: 921945659

View in Genome Browser
Species Human (GRCh38)
Location 1:220884368-220884390
Sequence GAGCAGCGACTCCGAGTCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921945657_921945659 8 Left 921945657 1:220884337-220884359 CCAGCCGTTCTGAAGGCGAGGCT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 102
921945656_921945659 9 Left 921945656 1:220884336-220884358 CCCAGCCGTTCTGAAGGCGAGGC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 102
921945658_921945659 4 Left 921945658 1:220884341-220884363 CCGTTCTGAAGGCGAGGCTGAGA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 102
921945654_921945659 10 Left 921945654 1:220884335-220884357 CCCCAGCCGTTCTGAAGGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921945659 Original CRISPR GAGCAGCGACTCCGAGTCCC TGG Exonic
900875741 1:5341397-5341419 CAGCAGCAACACCGAGTCTCAGG + Intergenic
901022106 1:6260839-6260861 GAGCAGCGAGCCGGAGCCCCGGG - Exonic
903197429 1:21701426-21701448 GAGCAGCCACTCGAAGCCCCTGG - Intronic
909419781 1:75450748-75450770 GAGCAGGTGCTCCAAGTCCCTGG - Intronic
912682734 1:111739380-111739402 GGGAAGCGACTCTGAGTCCCGGG - Exonic
921076369 1:211703113-211703135 GAGCAGGGACTATGTGTCCCAGG - Intergenic
921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG + Exonic
924540870 1:244979724-244979746 GAGCCACGACTCCCAGCCCCAGG + Intronic
1064391007 10:14942178-14942200 GTGCAGCTCCTCCGAGTCCTGGG + Intronic
1064401370 10:15024187-15024209 GTGCAGCTCCTCCGAGTCCTGGG + Intergenic
1064819104 10:19304184-19304206 GAGCAGCCACTCAGATTCCCTGG + Intronic
1066746094 10:38604908-38604930 CAGCAGCGCAGCCGAGTCCCAGG + Intergenic
1067076036 10:43183090-43183112 GAGGAGTGACTCCCAGTCACCGG - Intronic
1068840734 10:61611153-61611175 GAGCAGAGGCTCTGAGTGCCTGG - Intergenic
1069984539 10:72274366-72274388 GAGCTCGGACTGCGAGTCCCTGG + Exonic
1072804600 10:98416705-98416727 GAGCAGACACTCCCAGTCCCAGG + Exonic
1075028351 10:119003680-119003702 GAGCAGCCACTGTGACTCCCTGG + Intergenic
1075519872 10:123136876-123136898 GAGAAGGGACGCCGAGTCCTGGG - Intronic
1077121594 11:911208-911230 GAGTGGTGACTCCGGGTCCCCGG - Intronic
1083897461 11:65627246-65627268 GAGCAGAGACTAAGAGTCACGGG + Intronic
1084492550 11:69486682-69486704 GAGGAGCCTCTCCCAGTCCCAGG + Intergenic
1084656449 11:70522586-70522608 CAGCAGGGACTCGGAGGCCCTGG - Intronic
1084835697 11:71800551-71800573 GAGCAGCGCCTCCCAGTGGCCGG - Exonic
1098758162 12:74390507-74390529 GAGCAGATACTCCCAGCCCCTGG - Intergenic
1105737011 13:23281892-23281914 GAGCAGGGACTCTGGATCCCTGG - Intronic
1119490933 14:75032540-75032562 GAGCAGGGTCTCCCAGTCTCTGG + Intronic
1122930660 14:104931782-104931804 CAGCAGCGCCTCCAGGTCCCGGG - Exonic
1125594270 15:40874170-40874192 GCGCAGCGAAGCCGAGACCCGGG - Exonic
1129201879 15:74007651-74007673 GGGCAGACACCCCGAGTCCCAGG - Intronic
1129382680 15:75178011-75178033 GGGCAGCGATTCCCAGTCCTGGG - Intergenic
1130040935 15:80404631-80404653 GAGCTGCGGCTCCGCGCCCCCGG - Intronic
1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG + Intergenic
1132791221 16:1689828-1689850 GAGCAGAGACTCCCTGACCCAGG + Intronic
1136146898 16:28321289-28321311 GAGCAACGAGTCCGGGTTCCAGG - Exonic
1137247136 16:46714856-46714878 GATCAGCGACTCCCAGTCAGGGG + Intronic
1137272653 16:46912473-46912495 GAGCTGCCAATCAGAGTCCCAGG - Intronic
1141603019 16:85137603-85137625 GGGAAGCGCCTCCCAGTCCCGGG + Intergenic
1143471305 17:7177660-7177682 AAGCAGCGACTCCGAGGCGCGGG - Intronic
1143619168 17:8071436-8071458 GAGCAGGGACTCAGAGCTCCAGG + Intergenic
1143866157 17:9925607-9925629 GAGCAGCTTCTCCGTGTCCTTGG - Intronic
1145991321 17:29080877-29080899 GAAGAGCGAATCCGCGTCCCCGG + Intronic
1146679212 17:34794982-34795004 GAGAAGGGACTCCAAATCCCTGG - Intergenic
1146819542 17:35973797-35973819 GAGCAGGGACTCACAGTCCAGGG + Intergenic
1149298655 17:55284512-55284534 GATGAGCGACTCCCAGGCCCAGG - Intronic
1151657721 17:75503446-75503468 GAGCAGCGGCTACGACTCCATGG - Exonic
1152595261 17:81234685-81234707 GAGCATCGTCTCCGAATCACGGG - Intronic
1152617599 17:81345129-81345151 GAGCAGCCCCTCCTAGCCCCCGG - Intergenic
1157418127 18:47522987-47523009 CAGCAGTGACTCTGAGTCTCTGG + Intergenic
1161213442 19:3080452-3080474 GAGCTGTGACCCCGTGTCCCGGG + Intergenic
1161226847 19:3150823-3150845 GAACAGGGACTCCAAGGCCCAGG - Intronic
1165397921 19:35577313-35577335 GACCAGGGACTTCAAGTCCCTGG + Intergenic
1166983913 19:46648796-46648818 GGGCAGCGACTCCGAGTGCTCGG - Exonic
1167105954 19:47429961-47429983 GAGAAGGGAGGCCGAGTCCCAGG + Exonic
932209646 2:69915759-69915781 GAGCAGCGCCTCCCGGTCCCCGG + Intronic
934290270 2:91685847-91685869 GAGCAACGACACCGCGTACCCGG - Intergenic
935267710 2:101408973-101408995 GAGCAAAGACTCCGAGGGCCTGG - Intronic
935321717 2:101895987-101896009 GAGCAAGCACTCAGAGTCCCTGG + Intergenic
935672087 2:105564578-105564600 GAGCGGCCACTCTAAGTCCCAGG - Intergenic
936262375 2:110972839-110972861 CAGCAGAGACTCCGTGTCCATGG + Intronic
939204558 2:139083773-139083795 GAGCAGCGAGACTGAGTCACAGG - Intergenic
941164958 2:162074359-162074381 GAGCAGGGTCCCCGAGTCGCCGG - Exonic
1171025632 20:21628210-21628232 GAGCAGCAAAACTGAGTCCCCGG + Intergenic
1171414367 20:24967715-24967737 AGGCAGCGAGTCCAAGTCCCCGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1176159643 20:63641788-63641810 GCTCAGCGCCTCGGAGTCCCCGG + Intronic
1183597454 22:38821370-38821392 CAGCAGAGACTCAGAGTCCAGGG - Exonic
1185066939 22:48637088-48637110 GAGCAGCCTTTCCGAGTCACTGG + Intronic
950306415 3:11918014-11918036 GAGCAGCAACTCCATCTCCCAGG + Intergenic
950540421 3:13609161-13609183 GAGCACAGCCTCCGGGTCCCTGG - Intronic
952286083 3:31971034-31971056 GAGCAGCTGCTCCCACTCCCAGG + Intronic
954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG + Exonic
955182253 3:56683198-56683220 GAGGAGCGGCTCCGAGGACCGGG - Intronic
956615927 3:71172625-71172647 GGGCAGGGACTCCGAATCCTAGG + Intronic
960454579 3:117854820-117854842 GAGCAGCACCGCAGAGTCCCTGG + Intergenic
962142056 3:132800944-132800966 GAGCAGCAACTCGGAGGCTCAGG - Intergenic
964303771 3:155318639-155318661 GAGCATCCACTGCAAGTCCCTGG + Intergenic
966593986 3:181710718-181710740 GAGCATCGACCCCGCCTCCCAGG + Intergenic
973293312 4:48490681-48490703 GGCCCGCGACCCCGAGTCCCCGG + Exonic
981920122 4:150078191-150078213 GAGCAGCTCCTGCGGGTCCCGGG - Intergenic
985625123 5:981843-981865 GAGCAGAGACCCCAAGACCCCGG + Intergenic
985625146 5:981917-981939 GAGCAGAGACCCCAAGACCCCGG + Intergenic
985625188 5:982065-982087 GAGCAGAGACCCCAAGACCCCGG + Intergenic
986344325 5:6820352-6820374 AAGCAGCGACTTGGAGGCCCAGG - Intergenic
992321980 5:75622487-75622509 GAGCAGCAACCCCGAGTCCTGGG + Intronic
992696735 5:79296572-79296594 CAGTAGGGACTCTGAGTCCCAGG - Intronic
999272192 5:150302964-150302986 GAGCAGCGGCTCCACCTCCCGGG + Intronic
1005886581 6:30102081-30102103 CAGCAGCGGCTCCCAGTGCCAGG - Intergenic
1009265355 6:61547601-61547623 GAGCAGTGACTCTTAATCCCTGG + Intergenic
1018101105 6:160441207-160441229 GAGCAGAGACTCAGATTCCCTGG - Intronic
1025983691 7:66428997-66429019 GAGAGGGGACTCGGAGTCCCAGG - Intergenic
1026031504 7:66798361-66798383 GAGAAGGGACTCGGAGTCCCAGG + Intronic
1029125564 7:98292780-98292802 GAGCCGTGACTCCGACGCCCAGG + Exonic
1034099115 7:148436399-148436421 GAACAGAGACTCCAAGCCCCAGG + Intergenic
1034222009 7:149454120-149454142 GAGGGGCAACTACGAGTCCCTGG - Exonic
1035355161 7:158272250-158272272 GAGCCGCGTCTCCGGGGCCCGGG + Intronic
1035706775 8:1681844-1681866 GGGCCGTGACTCCCAGTCCCGGG - Intronic
1036397429 8:8381252-8381274 GAGCAGCTACAGCGAATCCCAGG + Intronic
1037977708 8:23224999-23225021 TGGCAGTGACTCCGAATCCCGGG - Exonic
1041381095 8:57254999-57255021 GAGCAGTGACTCCCTATCCCAGG - Intergenic
1049071149 8:140357156-140357178 GAGCAGAGGCCCAGAGTCCCTGG + Intronic
1053042241 9:34884739-34884761 GCTCAGGGACTCCCAGTCCCTGG + Intergenic
1053458372 9:38249529-38249551 GAGCAGGGACTCAGAGGCCATGG - Intergenic
1057083063 9:92187266-92187288 GAGCAGAGAATCCTAGTGCCAGG + Intergenic
1058826302 9:108778653-108778675 GAGCAGCTGCCCCCAGTCCCTGG + Intergenic
1059055353 9:110973364-110973386 CAGCAGCAACTCCGGTTCCCAGG + Intronic
1060280756 9:122214102-122214124 ACGCAGAGACTCCGAGACCCCGG + Intronic
1061860467 9:133465276-133465298 GAGCAGCGACTGACAATCCCAGG - Intronic
1061863200 9:133478442-133478464 GAGGAGGGACTCAGAGACCCTGG - Intronic
1061914110 9:133740134-133740156 GAGCTGTGACTACTAGTCCCTGG - Intergenic
1062374069 9:136254164-136254186 CAGCAGTGAGTCCGAGTCACCGG + Intergenic
1062534360 9:137015035-137015057 GAGCAGCTGCTCCGAGCTCCAGG - Exonic
1185835817 X:3345605-3345627 GAGACCCGACCCCGAGTCCCCGG - Intronic
1195078597 X:101350375-101350397 GAGCAGGGATTCTGAGTACCTGG + Intronic