ID: 921945796

View in Genome Browser
Species Human (GRCh38)
Location 1:220885134-220885156
Sequence ATGCAGCAGCTGAAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 283}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921945792_921945796 -7 Left 921945792 1:220885118-220885140 CCGGGGACACTGTAGAATGCAGC 0: 1
1: 0
2: 1
3: 14
4: 169
Right 921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 283
921945785_921945796 20 Left 921945785 1:220885091-220885113 CCAGAGATCTACAACCGGACCTT 0: 1
1: 0
2: 0
3: 0
4: 43
Right 921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 283
921945790_921945796 1 Left 921945790 1:220885110-220885132 CCTTAGTCCCGGGGACACTGTAG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 283
921945789_921945796 6 Left 921945789 1:220885105-220885127 CCGGACCTTAGTCCCGGGGACAC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 283
921945791_921945796 -6 Left 921945791 1:220885117-220885139 CCCGGGGACACTGTAGAATGCAG 0: 1
1: 0
2: 0
3: 14
4: 147
Right 921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG 0: 1
1: 0
2: 2
3: 24
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921945796 Original CRISPR ATGCAGCAGCTGAAGGTGGT GGG Intergenic
900567316 1:3339897-3339919 GTGCAGCAGCTGAGGTTGGAAGG + Intronic
900647167 1:3714250-3714272 TGGCAGCAGCTGGAGGTGGCCGG - Intronic
903492338 1:23739027-23739049 AGGCAGCATCTGAAGTTGCTTGG - Intergenic
904727575 1:32561403-32561425 ATGCTGCCTCTGAAGGTTGTAGG + Intronic
906345215 1:45010581-45010603 CTGCTGCCGCTGGAGGTGGTTGG + Exonic
906457308 1:46008188-46008210 ATGTAGCTGCTGAAGATGGTGGG + Intronic
906522181 1:46474166-46474188 ATGGAGGAGGTGAAGGTGATGGG + Intergenic
906677996 1:47707625-47707647 ACACAGCAGCTGCAGGTCGTGGG + Intergenic
906748146 1:48235854-48235876 GAGCAGGAGCTGATGGTGGTGGG + Exonic
906838575 1:49110734-49110756 GGGCAGCAGCTGATGGTGGATGG - Intronic
907045081 1:51295881-51295903 ATGCTGCTGCTGCTGGTGGTTGG - Intronic
908580855 1:65515089-65515111 AGCCAGCAGATGATGGTGGTGGG + Intronic
909387945 1:75081746-75081768 ATTAAGCAGCTTAAGGTAGTGGG - Intergenic
910746472 1:90580319-90580341 CTGCAGCAGCTGCAGGGGGAGGG - Intergenic
911118626 1:94272477-94272499 ATGCAGCAGCTGGAGGCTGTTGG - Intronic
911776083 1:101814633-101814655 AGGCAGCATCTTAAAGTGGTTGG + Intronic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
912570718 1:110619107-110619129 AGGCAGCTGCAGAGGGTGGTTGG - Intronic
913196095 1:116457476-116457498 ATGAAGCAGCAGCAGGTGGCGGG - Intergenic
913370302 1:118091820-118091842 ATGCAGGAGCTGTAGGTGAAGGG + Intronic
914355515 1:146881258-146881280 AGTCAGCAGCTGAGGGTGGGAGG - Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
918815129 1:189171629-189171651 AGGCAGCATCTGAAAGTGGATGG + Intergenic
919837282 1:201583527-201583549 AGGAGGCAGCTGAAGCTGGTAGG + Intergenic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
920205096 1:204285787-204285809 ATCCAGCAGCTTAAGGAGGCTGG + Intronic
921249547 1:213283568-213283590 GAGCAGCAACTGAAGGTGGAAGG + Intergenic
921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG + Intergenic
922561178 1:226570666-226570688 ATGCTGCAGCTCCAGGTGCTGGG - Intronic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
922720180 1:227896317-227896339 AGGCACCAGCTGAAGCTGCTGGG - Intergenic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
923494206 1:234510280-234510302 AATGAGCAGCTGAAGGTGCTGGG + Intergenic
924597673 1:245461591-245461613 ATGGTGCAGCTGGAGGTGATGGG - Intronic
924900281 1:248390416-248390438 CTGCAGCGACTGAAGATGGTGGG + Intergenic
1063633776 10:7761072-7761094 ATGCAGGAGCAGAAGGTAGGAGG + Intronic
1064316688 10:14263986-14264008 ATGCAGCAGCTCTTTGTGGTTGG - Intronic
1064796380 10:19016326-19016348 ATGCAGCAGCTTTAGCTGGGTGG + Intergenic
1065225604 10:23540675-23540697 AGCCAGAAGCTGAAGTTGGTGGG + Intergenic
1066538959 10:36423216-36423238 ATGCAGGAGTGGAAGGAGGTAGG - Intergenic
1067723919 10:48751832-48751854 ATGCAGCTGCTGTGGGTGGCAGG + Intronic
1068955629 10:62817182-62817204 GCGCAGCAGCTGAAGGGGGGCGG - Intronic
1072420776 10:95289610-95289632 GTCCAGCAGCTGAAGGAGTTTGG - Intronic
1072794486 10:98343994-98344016 ATCCAGCTGGTGAAGGTGGGAGG + Intergenic
1073221397 10:101877252-101877274 ATTCAGGAGGTGGAGGTGGTAGG + Intronic
1076117081 10:127907852-127907874 ATGCAGCAGCCGCCGGGGGTCGG + Intronic
1076634875 10:131875599-131875621 CAGAAGCAGCTGAAGGTGTTGGG - Intergenic
1077164624 11:1129508-1129530 CTGCAGCAGCTGGACGGGGTCGG - Intergenic
1078505767 11:11943077-11943099 ATGCTGCAGATGAAGGTTCTGGG + Exonic
1079499665 11:21088857-21088879 ATGCCACAGCTAAAGGTTGTTGG + Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1084415144 11:69027745-69027767 ATCTAGAAGCTGGAGGTGGTAGG + Intergenic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1086249848 11:84799381-84799403 ATGCAGCTGCTGCCGGAGGTTGG + Intronic
1086375615 11:86197197-86197219 ATGCAGCAGCTGCATTTGTTGGG - Intergenic
1088321504 11:108558735-108558757 ATGCTGCTGCTGAAGGTGATGGG + Intronic
1088619993 11:111671986-111672008 CTGCAGCAGCAGAAGATGGCTGG - Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1093974280 12:25403748-25403770 ATGCATCAACTGAAAGTGGAAGG + Intergenic
1094722085 12:33075585-33075607 ATGCAGGAGCCCAAGGTGGAGGG - Intergenic
1096257821 12:50073664-50073686 CTGCTGCTGCTGATGGTGGTGGG - Intronic
1096673424 12:53213692-53213714 ACGCAGCATCTGGAGGTGGGGGG + Exonic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099148711 12:79081041-79081063 GTGCAGAGGCTGAGGGTGGTGGG + Intronic
1102441382 12:112966404-112966426 CTGCAGCAGGTGGAGGAGGTGGG - Intronic
1102471349 12:113161590-113161612 ATGCCGCTGCTGAAGCTGCTGGG + Intronic
1102471363 12:113161645-113161667 ATGCTGCTGCTGAAGCTGCTGGG + Intronic
1102471374 12:113161701-113161723 ATGCTGCTGCTGAAGCTGCTCGG + Intronic
1102926339 12:116829133-116829155 ATGGGGCAGCTGAGGGTGGGTGG + Intronic
1105247988 13:18669878-18669900 ATCCACCAGCTGAAGGCCGTGGG + Intergenic
1106005833 13:25769525-25769547 ATGCAGAAGCTGAAGGTGAGAGG - Intronic
1106202294 13:27549544-27549566 ATGAAATAGCTGAAAGTGGTTGG - Intronic
1107111890 13:36707149-36707171 ATGCAGCACTTTAAGGGGGTGGG + Intergenic
1108551589 13:51551196-51551218 AGGCAATGGCTGAAGGTGGTTGG - Intergenic
1110427181 13:75381583-75381605 AGGAAGCAACTGAAGGTGGGGGG - Intronic
1110497889 13:76190371-76190393 ATGCAGGAGCTCACGGCGGTGGG - Intergenic
1111438739 13:88248730-88248752 ACACTGCAGCTGGAGGTGGTGGG - Intergenic
1112404228 13:99103839-99103861 CTGCAGCAGCTGAGGGTTGTTGG - Intergenic
1112611837 13:100962752-100962774 ATTCAGCAGCTGGAGCTGGGTGG + Intergenic
1112927368 13:104693189-104693211 CTGAAGCAGCTGGAGGTGATTGG - Intergenic
1113948664 13:114059183-114059205 ATGCAGGAGATGCAGGTGTTTGG - Intronic
1114402505 14:22422806-22422828 ATGGAGCACCTGAGGGTGGCAGG - Intergenic
1122077907 14:99247397-99247419 AGCCAGCTGCTGAAGGTGGCAGG + Intronic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1122790891 14:104183745-104183767 ACGCAGCTGCTGATGGTGGATGG + Intergenic
1124824311 15:33078301-33078323 ATGGAGCATGTGCAGGTGGTGGG + Intronic
1127634931 15:60859965-60859987 AAGCAGCAGGTGTAGGTGGTAGG - Intronic
1128752487 15:70159324-70159346 CTGCAGCATCTGCAGGTGGGGGG - Intergenic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1130635142 15:85611372-85611394 ATGCAGCAGAAGTAGGTGGCAGG - Intronic
1131429493 15:92375387-92375409 ATGCAGCTGCAGAAGGTATTAGG + Intergenic
1132263833 15:100448961-100448983 TGGCAGCACCTGCAGGTGGTTGG - Intronic
1132794017 16:1709653-1709675 AAACAGCAGCTGAACGGGGTGGG + Intronic
1133116553 16:3580901-3580923 AGGCAGCAGCTGGGGGTGCTTGG + Intergenic
1133429497 16:5724374-5724396 ATTCAGGAGCTGCAGGTGATGGG + Intergenic
1135495961 16:22951350-22951372 ATGAGGCAGCTGGAGATGGTTGG - Intergenic
1135764674 16:25167181-25167203 ATTCACCAGGTGAGGGTGGTGGG - Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136288352 16:29257451-29257473 AGGCTCCAGCTGAAGGTGGAAGG - Intergenic
1139604070 16:68005447-68005469 AGGCAGCAGCTGGAAGTGGAGGG - Intronic
1139978504 16:70834185-70834207 AGTCAGCAGCTGAGGGTGGGAGG + Intronic
1141449990 16:84092789-84092811 ATAAAACAGCTCAAGGTGGTAGG + Intronic
1141543094 16:84741980-84742002 TTGCTGCAGCTGGAGGTAGTGGG - Intronic
1142094033 16:88230234-88230256 AGGCTCCAGCTGAAGGTGGAAGG - Intergenic
1143053600 17:4146038-4146060 ATTCAGCCGCTGAAAGTGTTGGG + Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1145119641 17:20246197-20246219 ATGCAGTGGCTGCACGTGGTAGG - Intronic
1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG + Intronic
1146677880 17:34785951-34785973 TTGCAGGAGGTGAATGTGGTGGG - Intergenic
1147722970 17:42550072-42550094 ATGCAGCAGAGGAAGGGGGCAGG + Exonic
1147724182 17:42556299-42556321 ATGCAGCAGAGGAAGGGGGCAGG + Intergenic
1147744893 17:42688938-42688960 ATGGAGCTGCTCAAGGTGGATGG + Exonic
1148165724 17:45482890-45482912 AGGCTGCAGCTGAAGGTGGCAGG + Intronic
1148329307 17:46803880-46803902 ATGGCGCAGCTGAAGAGGGTGGG + Intronic
1148342492 17:46881652-46881674 ATTGAGCAGCTGGAGGTGGAGGG - Intronic
1148368246 17:47072731-47072753 AGGCTGCAGCTGAAGGTGGCAGG - Intergenic
1149580263 17:57745103-57745125 ATCCTGCAGCAGAAGGTGGCCGG - Exonic
1149640598 17:58200055-58200077 ATGAAGCAGCTGGAGCTGGGAGG - Intronic
1149652115 17:58281944-58281966 ATCCAGGAGCAGATGGTGGTGGG - Intergenic
1150396951 17:64829614-64829636 AGGCTGCAGCTGAAGGTGGCAGG + Intergenic
1151201443 17:72470658-72470680 ATGGTGCAGCTGAAGGGGGCCGG - Intergenic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1152095434 17:78269297-78269319 AAGCTGTAGCTGAAGGTGGGAGG - Intergenic
1152364765 17:79849266-79849288 ATGCACCAGCAGAAGGTGCAGGG - Intergenic
1152433728 17:80262922-80262944 AGCCAGCAGAAGAAGGTGGTGGG + Intronic
1153864949 18:9257755-9257777 ATTCAGCATCTGAAAGTGATTGG - Exonic
1154440865 18:14389250-14389272 ATCCACCAGCTGAAGGCCGTGGG - Intergenic
1157469333 18:47976511-47976533 ATCCAGCAAATGAAGGTGCTGGG + Intergenic
1157523386 18:48360816-48360838 ATGCAGCAGCTGGTGGTGGTGGG + Intronic
1158578585 18:58661523-58661545 AAGCAGCAGCAGCAGCTGGTAGG + Intergenic
1158764837 18:60437425-60437447 AGGCAGCAGCAGCAGGTTGTAGG + Intergenic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159055077 18:63455252-63455274 GTGCACCAGCTGCAGGTGGGAGG - Intergenic
1159645228 18:70910385-70910407 AAGGAGCAGCTGAAGTTTGTTGG + Intergenic
1160480145 18:79232449-79232471 CTGCTGCAGCTGTAGGTGTTAGG - Intronic
1160543841 18:79640054-79640076 ATTCATCAGCTCAAGTTGGTGGG - Intergenic
1161768687 19:6220061-6220083 AGGCAGCAGCTGGAGGACGTGGG + Intronic
1163273563 19:16268673-16268695 GGGCAGCGGCTGAAGGAGGTAGG + Intergenic
1164851482 19:31487905-31487927 TTGCAATAGCTGAAGGTGGAAGG - Intergenic
1165503357 19:36207848-36207870 ATGATGCAGCTAAAGGTGGCGGG + Intronic
1165782825 19:38443797-38443819 GTGCAGCAGCTGGAGGGGATGGG + Intronic
1166652420 19:44584489-44584511 ATGAGGCAACAGAAGGTGGTTGG - Intergenic
1167751540 19:51383481-51383503 ATGCACCAGGTGTAGGTGCTGGG - Intronic
1168527903 19:57103467-57103489 GTGCAGGAGATGACGGTGGTGGG - Intergenic
925292345 2:2756154-2756176 AGGCAGAAGCTGAGGGTGGCAGG - Intergenic
925354664 2:3230384-3230406 ACGCTGCAGCTGAAGGGGGTGGG + Intronic
926083041 2:10004205-10004227 ATACAGCAGGTGAAGGAGGTTGG - Intergenic
927056882 2:19373556-19373578 ATGCAGCAGCTCACAGGGGTTGG + Intergenic
928434367 2:31244625-31244647 ATGCAGCAGCTGCAAATGCTGGG + Intronic
928772541 2:34719647-34719669 ATGCAGCTGCTGTCGGGGGTGGG + Intergenic
929662357 2:43799680-43799702 ATGCAGCAGATGGAGGAGTTGGG + Intronic
933220641 2:79683745-79683767 TTGCAGGAGCTGCAGGTGCTGGG + Intronic
937072183 2:119072902-119072924 ATACAGCAGCTAAGGGTAGTGGG - Intergenic
938549404 2:132366619-132366641 TGGCAGCAGTTGGAGGTGGTGGG - Intergenic
939995576 2:148916111-148916133 ATGCAGGAGCTGACTGTGGGAGG + Intronic
940370356 2:152894529-152894551 ATGCAGCAGTGGGAGCTGGTGGG + Intergenic
940905012 2:159161082-159161104 ATGGAGCAGCTGAGGATGGCTGG - Intronic
942579026 2:177396459-177396481 ATGAAGCAGCTGAAGGGGCTTGG + Intronic
943527870 2:189040229-189040251 ATTCAGGAGGTGAAGGTGGGAGG - Intronic
943635773 2:190305350-190305372 ATGCTCCTGCTGAAGGTGCTAGG + Intronic
944287349 2:197966600-197966622 ATGCAGCTGCTGCAGGGGATGGG + Intronic
946954270 2:224911626-224911648 AGGCAGGAGCTGAAGGAGGCTGG + Intronic
947480764 2:230497679-230497701 ATTCAGCAGGTGATGGGGGTAGG - Intronic
947831655 2:233145835-233145857 ATGCAGCAGGTGTAGGAGGGAGG + Intronic
948526081 2:238571660-238571682 CTGCCGCAGCTGCAGGTGCTTGG - Intergenic
1168982806 20:2022252-2022274 ATGCAGCAGCAGGAGATTGTGGG + Intergenic
1169329917 20:4708279-4708301 ATGCATCAGCTGAAGCAGGCAGG - Intergenic
1169498108 20:6133912-6133934 AGGGAGCACCTGAAGGAGGTGGG - Intergenic
1170107034 20:12762949-12762971 CTGCAGCAGATGAAGCTGGCTGG - Intergenic
1172143930 20:32743315-32743337 ATGCAGCAGCTGAACCAGCTGGG - Exonic
1175588751 20:60169943-60169965 ATGCAGCAGGTGAAGAAAGTTGG + Intergenic
1175836731 20:62000846-62000868 ATGCAGCAGGTGCAGGTGCGGGG - Intronic
1176304050 21:5114224-5114246 ATGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176455188 21:6901934-6901956 ATCCACCAGCTGAAGGCCGTGGG + Intergenic
1176833360 21:13766982-13767004 ATCCACCAGCTGAAGGCCGTGGG + Intergenic
1178545692 21:33491513-33491535 AGGCACCAGCTGGAGGCGGTGGG - Intronic
1178840646 21:36135331-36135353 GTGCAGCAGCTGCAGGCGGAGGG + Exonic
1179197010 21:39173689-39173711 AGGCAGCAGGTGCAGGAGGTTGG - Intergenic
1179780973 21:43700795-43700817 ATGCAACAGCTGCAGATGGCCGG + Intergenic
1180737190 22:18025906-18025928 ATGCCACAGCTGAAGGTGCAAGG + Intergenic
1182104821 22:27681805-27681827 ATGCAGGGGCTGCAGGTTGTGGG + Intergenic
1182534320 22:30989086-30989108 ATGTAGCATCTCAAAGTGGTTGG - Intergenic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183338053 22:37262215-37262237 CAGCAGCAGCAGATGGTGGTGGG + Intergenic
1183363875 22:37397082-37397104 ATGCCCGAGCTGAAGCTGGTAGG - Intronic
1184015318 22:41781671-41781693 CTGCAGCAGCTGTCGGGGGTGGG - Exonic
1184511933 22:44939055-44939077 GTGCAGCTGCTGCAGATGGTCGG - Intronic
950155042 3:10715690-10715712 ATGCTGGAGCTGAGTGTGGTGGG + Intergenic
950626231 3:14249160-14249182 ATGCAGCTGCTGGGGCTGGTGGG - Intergenic
953422373 3:42764511-42764533 CTGCAGCATCTGGAGGTGGCAGG - Intronic
954123197 3:48512683-48512705 ATGCACCAGCTCAAGCTGTTGGG + Intergenic
954199443 3:49015421-49015443 GTGCAGGAGCTGAAGGTGAGTGG + Exonic
955353748 3:58213499-58213521 ATGCAGCACCTGAACCTAGTTGG - Intronic
958640648 3:96800684-96800706 ATGCACCTGCAGGAGGTGGTTGG + Intergenic
959214745 3:103437347-103437369 GTGGAGCTGCTGAAGGTGGTGGG - Intergenic
960814474 3:121658677-121658699 AGGCAGTGGCTGGAGGTGGTTGG + Intronic
961115559 3:124326187-124326209 CTGCAGCAGCTGCTGTTGGTAGG + Intronic
961263183 3:125618933-125618955 ATGAAGCAGGTGAAGAAGGTGGG + Intergenic
961268814 3:125671956-125671978 ATGCAGGAGCCCACGGTGGTGGG - Intergenic
962886633 3:139633689-139633711 ACACAGCAGCTGAAGGTGGGAGG + Intronic
964056410 3:152465569-152465591 TTTCAGCAGATGAAAGTGGTAGG - Exonic
964117194 3:153148663-153148685 ATACACCAACTGAGGGTGGTGGG - Intergenic
967329472 3:188276299-188276321 ATGAAGTAGATGAAGGTTGTTGG + Intronic
968454086 4:688526-688548 GTGCAACACCTGAAGGGGGTGGG + Intronic
969063945 4:4462236-4462258 ATGCTGCAGTTGCAGGGGGTTGG - Intronic
970200753 4:13602121-13602143 TTGCTGCAGCTGAAGAAGGTGGG - Exonic
971414877 4:26415614-26415636 ATGCAGCAGCTAAACTTGGAAGG + Exonic
973735450 4:53866782-53866804 ATGCAGGTGATGAAGGTGGCTGG - Intronic
974385644 4:61200473-61200495 ATGCAGATGCTGCAGCTGGTCGG + Intergenic
976502336 4:85806049-85806071 ATGAAGCAGCTGAATGGGGTAGG - Intronic
976725661 4:88213439-88213461 AGGCAGCAGATGCAGGTGGGTGG - Intronic
977632069 4:99254049-99254071 CTTGAGCAGCTGAAGGTGGGTGG + Intergenic
977642505 4:99372720-99372742 ATGCCCAAGCTGAAGGTTGTGGG + Intergenic
978159687 4:105530727-105530749 ATGCTGCAGCTGAATATGGCTGG - Intergenic
978723615 4:111944534-111944556 ATGCAGATGCTGATTGTGGTTGG - Intergenic
980579813 4:134734646-134734668 TTTCAGCAGCTGAAGGTGTCTGG + Intergenic
980702038 4:136443260-136443282 ATGCAGCAGCTGCAGTGGGGTGG - Intergenic
980955677 4:139427153-139427175 CTGCAGCTGATGAACGTGGTGGG - Intergenic
983912764 4:173258504-173258526 TTGCAGCAGCTGATGGAGATGGG + Intronic
985695215 5:1336228-1336250 ATGCAGCAGGTGCAGGAAGTCGG - Intronic
985975742 5:3417945-3417967 AGGCAGCAGCTGAGCGTGGAAGG - Intergenic
988693816 5:33598910-33598932 ATGCAGCAGATGAAGTTGCTTGG - Intronic
992896897 5:81253438-81253460 ATGCAGAAGCACAGGGTGGTCGG + Intronic
994067798 5:95562702-95562724 ATGCAGCAACTAAAGGCAGTTGG + Intronic
995371737 5:111426762-111426784 AGGCATCAGCTGAATTTGGTTGG - Intronic
995499720 5:112791460-112791482 ATGCAGCCACTGATGGTGGCAGG - Intronic
996804821 5:127442746-127442768 ATGTAGCAGCTGAAAGTGTCAGG + Intronic
997280708 5:132642971-132642993 ATGTAGGAGAAGAAGGTGGTGGG - Exonic
998861221 5:146446151-146446173 ATGCATCAGCTGATGGTCATTGG + Intergenic
1001171620 5:169424834-169424856 ATGCAGAAGCTGAAGTTGCAAGG - Intergenic
1002581671 5:180212595-180212617 ACGCAGGGGCTGAAGGTGCTGGG - Intergenic
1002902948 6:1425033-1425055 ATGTTGCAGCTGAAGGGGGCTGG - Intergenic
1003817897 6:9862530-9862552 GTGGAGCAGCTCAAGGTGTTGGG - Intronic
1004642113 6:17525545-17525567 ATGCAGCCGCTGAGGATGGAAGG - Intronic
1005893100 6:30156007-30156029 ATGCAGCTGCTGCTGCTGGTGGG + Intronic
1005917466 6:30365807-30365829 GTGCAGCAGCTAAAGGTTGTGGG - Intergenic
1006114806 6:31769908-31769930 ATCTAGGTGCTGAAGGTGGTGGG + Intronic
1006302127 6:33199318-33199340 ATGGAGCTGTTGAAGGGGGTAGG + Exonic
1006955930 6:37871910-37871932 ATTTAGCTGCTGATGGTGGTGGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1008230787 6:48983508-48983530 ATGCAGGAGCCCATGGTGGTGGG + Intergenic
1011441032 6:87387685-87387707 ATATTGCAGCTGAAGGTGGCTGG + Intronic
1011856675 6:91701765-91701787 ATGCAGGAGGCTAAGGTGGTAGG - Intergenic
1013152351 6:107459020-107459042 ATGCAGGTGCGGAAGCTGGTGGG - Exonic
1013366223 6:109440502-109440524 CCGCTGCAGGTGAAGGTGGTGGG - Exonic
1013413691 6:109905529-109905551 CTCTACCAGCTGAAGGTGGTAGG + Intergenic
1013653081 6:112216117-112216139 AACCAGCTGCTGAGGGTGGTGGG + Intronic
1013710846 6:112896296-112896318 ATATTGCAGCTGAAGGTGGCTGG + Intergenic
1013899619 6:115138827-115138849 ATGTAGCTGCTGAACGTAGTGGG - Intergenic
1016384689 6:143518985-143519007 CTGCAGCCTCTCAAGGTGGTGGG + Intergenic
1016932407 6:149424296-149424318 ACGCAGCAAATGGAGGTGGTGGG - Intergenic
1018008249 6:159643293-159643315 ATCCAGCAGCTCAGTGTGGTTGG - Intergenic
1018992349 6:168683853-168683875 CTGCAGCAGCTGAAGGCCGCAGG - Intergenic
1019162320 6:170076825-170076847 TAGCAGCAGCTGCAGGTGGCCGG - Intergenic
1019483004 7:1274946-1274968 TGGAAGCAGCTGAAGGTGTTGGG + Intergenic
1020100408 7:5391167-5391189 ACCCAGCAGCTGAAGATGCTGGG - Intronic
1020361928 7:7336038-7336060 TTTAAGCAGCTGAATGTGGTTGG + Intergenic
1020370280 7:7424556-7424578 ACGCAACAGCTGAGGGTTGTTGG + Intronic
1021105275 7:16631522-16631544 TTGCAGCTTTTGAAGGTGGTAGG + Intronic
1022130400 7:27399736-27399758 ATGCAGGAGCTGAAGGTATTAGG - Intergenic
1023372883 7:39529707-39529729 ACCCAGCAGCAGAGGGTGGTGGG + Intergenic
1024270399 7:47637140-47637162 ATGCAGCGGCTGGAGGAGGGGGG - Intergenic
1026621280 7:71952002-71952024 ATGCGGCTGCTGATGGTGGAGGG + Intronic
1027139664 7:75648235-75648257 TTGGAGTAGCTGAAGCTGGTTGG + Intronic
1028311331 7:89340991-89341013 AAGCAGCAGCTGAATGGGTTAGG + Intergenic
1029124636 7:98287741-98287763 GAGCAGCAGCTGCAGGTGGGAGG + Intronic
1030375162 7:108745657-108745679 ATGCACCTGCAGAAGGTGGTTGG + Intergenic
1031843499 7:126775870-126775892 GTGCAGCAGATGAAGCTGGAGGG - Intronic
1034231883 7:149536401-149536423 CTTCAGCAGCTGAATGTGCTTGG - Intergenic
1034443661 7:151101004-151101026 ATGGGGGACCTGAAGGTGGTTGG - Intronic
1035921825 8:3685461-3685483 ATGCTGCAGCCGAAGGAGATGGG + Intronic
1036029997 8:4959514-4959536 ATGGAGCAGCTGGAAGTTGTTGG - Intronic
1036577456 8:10041252-10041274 ATGATGCAGCTGTAAGTGGTAGG - Intergenic
1037731726 8:21531250-21531272 ATGCAGCAGTTGAAAGCAGTAGG + Intergenic
1038243553 8:25832536-25832558 AGGCAGCAGCTGGAGGAGGTGGG - Intergenic
1038446795 8:27610226-27610248 ATGCAACAGCCGAAAGTGCTTGG + Intronic
1038490226 8:27965399-27965421 ATGAAGCAGGTGGAGTTGGTGGG - Intronic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1043464088 8:80487419-80487441 CTGCAGCAGCAGCAGGCGGTCGG + Exonic
1046491875 8:114964021-114964043 ATCCAGCAGGTTAAAGTGGTAGG - Intergenic
1046962668 8:120126483-120126505 TGGCAGCAGCTGAAGGGGGTGGG + Intronic
1048170832 8:132104683-132104705 ATGAAGGAGGTGGAGGTGGTAGG + Intronic
1048448772 8:134513026-134513048 ATGGGGCAGCTGACGGTGGAAGG + Intronic
1048842658 8:138579099-138579121 GGGCAGCTCCTGAAGGTGGTTGG + Intergenic
1048982090 8:139708029-139708051 ATGCTGCAGCTGAATGAGTTTGG - Intergenic
1052894978 9:33738363-33738385 ATGCTGCACCTAAAGGTGGATGG - Intergenic
1053043121 9:34891480-34891502 ATGCAGCACCAGAAGCTAGTGGG - Intergenic
1053613569 9:39740879-39740901 ATGCAGCAGCTAAACTTGGAAGG - Intergenic
1053871610 9:42498836-42498858 ATGCAGCAGCTAAACTTGGAAGG - Intergenic
1054239945 9:62601518-62601540 ATGCAGCAGCTAAACTTGGAAGG + Intergenic
1054554078 9:66636044-66636066 ATGCAGCAGCTAAACTTGGAAGG + Intergenic
1054755299 9:68951462-68951484 AAGCAGCAGGTGAGGGTGGTTGG - Intronic
1055505356 9:76942541-76942563 ATGAAGGAGCTGAAGTTGCTTGG - Intergenic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1056455729 9:86757573-86757595 ATGCAGCAGCTGAGGCTGTTTGG - Intergenic
1057940240 9:99275685-99275707 ATGCAGAATCTGGAAGTGGTAGG - Intergenic
1058435808 9:104962093-104962115 ATGCCTTGGCTGAAGGTGGTAGG - Intergenic
1062151537 9:135021690-135021712 ATGGAGCAGCTGCTGGTGCTGGG + Intergenic
1185702707 X:2243149-2243171 CAGCAGCCGCTGGAGGTGGTAGG + Exonic
1185830960 X:3302513-3302535 AAGCTGCAGCTGAAGTTGGATGG + Intergenic
1189888767 X:45577278-45577300 AGGGACCAGCTGAAGTTGGTGGG + Intergenic
1190097138 X:47490816-47490838 ATTCAGCAGCTGAAACTGGGAGG + Intergenic
1192631614 X:72781929-72781951 ATGGAGCAGCAGAAGGGGCTTGG + Intronic
1192650095 X:72938872-72938894 ATGGAGCAGCAGAAGGGGCTTGG - Intronic
1194358784 X:92920618-92920640 ATGCTGAAGCTGCAGGGGGTGGG + Intergenic
1197309262 X:124883944-124883966 ATGCAGGTGCTGACTGTGGTCGG + Intronic
1198694751 X:139324237-139324259 ATGCAGCTGCTGCAGCAGGTGGG - Intergenic
1199486824 X:148357489-148357511 ATGGCTCAGGTGAAGGTGGTTGG - Intergenic
1200666950 Y:6036312-6036334 ATGCTGAAGCTGCAGGGGGTGGG + Intergenic