ID: 921945920

View in Genome Browser
Species Human (GRCh38)
Location 1:220886045-220886067
Sequence GATTGGCACTGAGACTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921945920_921945923 1 Left 921945920 1:220886045-220886067 CCTGATCAGTCTCAGTGCCAATC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 921945923 1:220886069-220886091 CTTCGGCACTGAGCAAGTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 112
921945920_921945925 16 Left 921945920 1:220886045-220886067 CCTGATCAGTCTCAGTGCCAATC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 921945925 1:220886084-220886106 AGTGAAGGACACAAGGTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 191
921945920_921945924 9 Left 921945920 1:220886045-220886067 CCTGATCAGTCTCAGTGCCAATC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 921945924 1:220886077-220886099 CTGAGCAAGTGAAGGACACAAGG 0: 1
1: 0
2: 2
3: 16
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921945920 Original CRISPR GATTGGCACTGAGACTGATC AGG (reversed) Intergenic
901904757 1:12398671-12398693 TGATGGCACTGATACTGATCAGG + Intronic
904664925 1:32112889-32112911 GATGGCTGCTGAGACTGATCAGG + Intronic
905480338 1:38257598-38257620 CATTGGCACTGAGACTTAGAGGG + Intergenic
906216694 1:44045236-44045258 GGTTGGCACCGTGTCTGATCCGG + Intergenic
908248459 1:62246471-62246493 GCTTGGCCCTGAGTCTCATCTGG - Intronic
909354319 1:74690129-74690151 GACAGGCACTGGGACTGATAGGG + Intergenic
913547582 1:119884757-119884779 GATTTGCAGTCAGACTGATCTGG + Intergenic
921079428 1:211726700-211726722 GATGGGTACTGTGACTGAACGGG + Intergenic
921945920 1:220886045-220886067 GATTGGCACTGAGACTGATCAGG - Intergenic
923003925 1:230029856-230029878 GATTGGATCTGAGATTAATCAGG - Intergenic
1069340345 10:67402530-67402552 TTTTCGCACTGGGACTGATCAGG + Intronic
1069396157 10:67991532-67991554 TATTGGCAGTGAGCCTAATCTGG + Intronic
1072695583 10:97600603-97600625 GATTGGAACAGAATCTGATCAGG - Intronic
1074767290 10:116708642-116708664 GATAGGAACTGAGCCTCATCAGG - Intronic
1079495930 11:21044066-21044088 GATTGGCAGAGAGAATGATAGGG + Intronic
1080335104 11:31186521-31186543 GAGTGGCACTGAGGCTGTTCTGG - Intronic
1080850073 11:36060564-36060586 GATTGGGATTCAGTCTGATCTGG + Intronic
1080934850 11:36851970-36851992 GACTGGCACTGAAACAGAGCAGG + Intergenic
1081277873 11:41172491-41172513 GCTAGGCACTGAGTCTTATCAGG - Intronic
1081679260 11:44990259-44990281 GATTGGCACTGAGGCAGCCCTGG + Intergenic
1081856775 11:46308864-46308886 GACTGGCTCTGAGACTCCTCAGG + Intronic
1087080531 11:94166959-94166981 GATTGGCACTCAGATTTATTTGG + Intronic
1087081989 11:94179834-94179856 AGTTTGCACTGAAACTGATCGGG - Exonic
1092064835 12:5581329-5581351 GTTTGGCAAGGAGACTGATGGGG + Intronic
1092660321 12:10731805-10731827 GATTCAAACTGAGACTCATCAGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1101420382 12:104545936-104545958 GATGGGCACGGAGACTGAGATGG - Intronic
1102542004 12:113627679-113627701 GATTGCCATTGGGACTGATCTGG + Intergenic
1103979850 12:124729748-124729770 GTCTGGCCCTGAGACTGTTCTGG - Intergenic
1104644655 12:130488281-130488303 GATGGGCTTTGAGACTGATGAGG + Intronic
1107867147 13:44714035-44714057 GAGTGGATCTGAGACTCATCTGG - Intergenic
1108258230 13:48630957-48630979 CATTTGCACTGAGAGTGAGCGGG + Intergenic
1108911171 13:55553175-55553197 TATTGTCACTGTGATTGATCTGG - Intergenic
1115448050 14:33514410-33514432 GCTTTGCACTTAGACTGATTTGG + Intronic
1116797724 14:49409728-49409750 CATTGACAGTGAGAATGATCAGG + Intergenic
1125454491 15:39843465-39843487 TATTGTAACTGGGACTGATCTGG - Intronic
1126223477 15:46242285-46242307 GATTGGAACTAAGACTGATATGG - Intergenic
1126441593 15:48695413-48695435 GTTTGGGAATGAGACAGATCTGG + Intergenic
1126859307 15:52868924-52868946 AATTGGGACTGAGAATGCTCAGG + Intergenic
1138101937 16:54258956-54258978 GGTTGTCACTGTGACTCATCAGG - Intronic
1139270007 16:65673069-65673091 GATTGACACCGAGTCTGTTCTGG - Intergenic
1140570747 16:76103787-76103809 GTCTGGCACTGGGGCTGATCTGG + Intergenic
1141484719 16:84330991-84331013 GATTGGAACTCAGGCTGAACAGG - Intergenic
1143651263 17:8265440-8265462 GGTTGGCACTGAGACCGTGCGGG + Exonic
1144369421 17:14575835-14575857 GATTGGCTCTGAACCTGAACGGG + Intergenic
1146586808 17:34089831-34089853 CAGTGGCACAGAGAGTGATCTGG - Intronic
1148428544 17:47622435-47622457 TTTTGGCACGGGGACTGATCAGG + Exonic
1158679428 18:59553627-59553649 GAGTGGCACTGCGACTGGTCTGG - Intronic
1159113579 18:64088365-64088387 GAATGGCCCTGAAACTGATCAGG + Intergenic
1162659950 19:12161159-12161181 GATCCACACTGAGACTAATCTGG + Intergenic
1162872650 19:13598139-13598161 GATTGGAGCTGAGGCTGATATGG - Intronic
1163047913 19:14658578-14658600 TATTGGAACTGAGAGTGACCAGG + Intronic
1163087948 19:14996329-14996351 GATGGGCACTGAGTTTCATCTGG + Intronic
1167670537 19:50850443-50850465 GGTGGGCACTGAGACTGCACTGG - Intergenic
927255680 2:21038686-21038708 GATGGGCAAAGAGACTGATATGG - Intronic
939664927 2:144939749-144939771 GATTGACACTGACACAGACCGGG + Intergenic
945164046 2:206923313-206923335 GATTGGCACTGTGACTTGTTTGG - Intergenic
947191490 2:227510561-227510583 GATAGGCACTCAGACTGCCCAGG + Intronic
1168943100 20:1730143-1730165 GATTGACCCTGACACTCATCAGG - Intergenic
1170258974 20:14381127-14381149 TTTTGGAACAGAGACTGATCTGG + Intronic
1177592550 21:23189917-23189939 GAGTTGCACTGATACTGATGTGG - Intergenic
1179287777 21:39992894-39992916 GAGTGGCAGTGAGACTTATGCGG - Intergenic
1183033575 22:35123687-35123709 CATGGGCTCTGAGACTGCTCAGG - Intergenic
1183795370 22:40112723-40112745 CATTGACACTGAGATTGATAGGG + Intronic
1185343764 22:50302632-50302654 TGTTGGCACCGAGCCTGATCTGG - Intronic
954659432 3:52219070-52219092 GAGTGGCTCTGAGACTATTCTGG - Intergenic
955084038 3:55685269-55685291 GATTTGCACAGAGTCTGAACTGG + Intronic
958702722 3:97615064-97615086 TACTTGCACTGGGACTGATCAGG + Intronic
963519452 3:146346101-146346123 CATTTGCATTGAGACTGATCAGG - Intergenic
965422809 3:168483042-168483064 GATTGGCACAATGAATGATCTGG + Intergenic
967397757 3:189025410-189025432 GACTCGCATTGGGACTGATCAGG - Intronic
969779488 4:9387396-9387418 GCTTAGCACTGAGAATGAACTGG - Intronic
970585391 4:17510232-17510254 GATTGGAAATCAGACAGATCAGG + Intronic
972031917 4:34471355-34471377 GATTGGCGCTGAGTTTGCTCAGG + Intergenic
975725304 4:77285694-77285716 GATTGTGACTGAGACTGAATGGG - Intronic
981575310 4:146197976-146197998 CAATGGCACTGAAATTGATCTGG - Intronic
983045251 4:162979470-162979492 AACTGGAACTGAGACTGCTCAGG + Intergenic
989261679 5:39425301-39425323 GATTGCCACTGCGAGTGATGTGG + Intronic
998229168 5:140348436-140348458 GAATGGGACTGAGGCTGATGTGG - Intergenic
1000273396 5:159709382-159709404 GATCAGTACTGAGAGTGATCAGG + Intergenic
1000361642 5:160453156-160453178 CATTGGCACTGAGAAATATCCGG + Intergenic
1001080810 5:168665814-168665836 GAGTGGCAGTGAGACTGAGAAGG + Intronic
1002883679 6:1274863-1274885 CATTCGCACTGATACTGCTCAGG - Intergenic
1005072060 6:21871050-21871072 GAGGTGCACTGAGACTGAGCAGG + Intergenic
1010155531 6:72787845-72787867 GATTGGCCCTCAGGCTGATAAGG - Intronic
1010812459 6:80315463-80315485 TACTTGCACTGGGACTGATCAGG - Intronic
1011444256 6:87420953-87420975 AATTGTCACTAAGACTGATGGGG - Intronic
1012595586 6:101034657-101034679 GTTTTGCTCTGGGACTGATCAGG - Intergenic
1015137380 6:129888727-129888749 GATTGATACTGATACTGATATGG + Intergenic
1015211146 6:130700789-130700811 GATTGCCACTGAGACTGACATGG + Intergenic
1019932307 7:4231869-4231891 TATGGGCACTGAGACTGCTCCGG - Intronic
1020178780 7:5904907-5904929 AATTGGTACTGAGACTGAGTTGG + Intronic
1026321971 7:69276178-69276200 GCTTGGCACTGAGTCTGGTGGGG + Intergenic
1030641591 7:112012360-112012382 CTTTGGCAATGAGACTGATAAGG + Intronic
1033523440 7:142185879-142185901 GATTAGAGCAGAGACTGATCTGG + Intronic
1038454680 8:27665155-27665177 GGTTGGAACTGAGACTGCACAGG + Intronic
1043074828 8:75684991-75685013 GGTTGGCACTGGGCCTGATATGG + Intergenic
1050397793 9:5217875-5217897 GATTAGCACTGAGAGTGTTGAGG - Intergenic
1053433667 9:38060768-38060790 TCTTGGCACAGAGACTGTTCTGG - Intronic
1057901717 9:98954008-98954030 GATGGGCACTGAGTCTAATGCGG - Intronic
1058200270 9:102029272-102029294 TACTGGCATTGGGACTGATCAGG - Intergenic
1061946140 9:133908996-133909018 GATTGGGAATGAACCTGATCCGG + Intronic
1062515185 9:136929925-136929947 GAACGCCGCTGAGACTGATCAGG + Intronic
1185780805 X:2843202-2843224 GATTTTCACAGTGACTGATCAGG + Exonic
1186503545 X:10071731-10071753 GACTGGCACTGAGGGAGATCTGG - Intronic
1187077455 X:15949086-15949108 GATTGAGAGTGAGACTGATGTGG - Intergenic
1196606516 X:117663370-117663392 GGTGGGCACTGAGACTAGTCAGG - Intergenic
1200427189 Y:3034587-3034609 CACTGCCACTGAGAGTGATCTGG + Intergenic
1201289269 Y:12406926-12406948 GATTTTCACAGTGACTGATCAGG - Intergenic