ID: 921947424

View in Genome Browser
Species Human (GRCh38)
Location 1:220895627-220895649
Sequence CAGCGCAATTATCACGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921947424_921947428 10 Left 921947424 1:220895627-220895649 CCCAGGGCGTGATAATTGCGCTG No data
Right 921947428 1:220895660-220895682 ACTGTGAGTCGCTGTGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921947424 Original CRISPR CAGCGCAATTATCACGCCCT GGG (reversed) Intergenic
No off target data available for this crispr