ID: 921947428

View in Genome Browser
Species Human (GRCh38)
Location 1:220895660-220895682
Sequence ACTGTGAGTCGCTGTGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921947425_921947428 9 Left 921947425 1:220895628-220895650 CCAGGGCGTGATAATTGCGCTGG No data
Right 921947428 1:220895660-220895682 ACTGTGAGTCGCTGTGACACTGG No data
921947422_921947428 12 Left 921947422 1:220895625-220895647 CCCCCAGGGCGTGATAATTGCGC No data
Right 921947428 1:220895660-220895682 ACTGTGAGTCGCTGTGACACTGG No data
921947420_921947428 26 Left 921947420 1:220895611-220895633 CCATTTAGCAATTACCCCCAGGG No data
Right 921947428 1:220895660-220895682 ACTGTGAGTCGCTGTGACACTGG No data
921947424_921947428 10 Left 921947424 1:220895627-220895649 CCCAGGGCGTGATAATTGCGCTG No data
Right 921947428 1:220895660-220895682 ACTGTGAGTCGCTGTGACACTGG No data
921947423_921947428 11 Left 921947423 1:220895626-220895648 CCCCAGGGCGTGATAATTGCGCT No data
Right 921947428 1:220895660-220895682 ACTGTGAGTCGCTGTGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921947428 Original CRISPR ACTGTGAGTCGCTGTGACAC TGG Intergenic
No off target data available for this crispr