ID: 921956973

View in Genome Browser
Species Human (GRCh38)
Location 1:220994884-220994906
Sequence CTGTGGATGTGGTGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921956963_921956973 13 Left 921956963 1:220994848-220994870 CCATTGCAAAGGGCCAACTGGAA No data
Right 921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG No data
921956962_921956973 14 Left 921956962 1:220994847-220994869 CCCATTGCAAAGGGCCAACTGGA No data
Right 921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG No data
921956966_921956973 0 Left 921956966 1:220994861-220994883 CCAACTGGAAAATGTGTGTGGGC No data
Right 921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG No data
921956957_921956973 26 Left 921956957 1:220994835-220994857 CCTGGGTGCTTCCCCATTGCAAA No data
Right 921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG No data
921956960_921956973 15 Left 921956960 1:220994846-220994868 CCCCATTGCAAAGGGCCAACTGG No data
Right 921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921956973 Original CRISPR CTGTGGATGTGGTGGGGAGA AGG Intergenic
No off target data available for this crispr