ID: 921958767

View in Genome Browser
Species Human (GRCh38)
Location 1:221012273-221012295
Sequence CTGCAGGATAAAATGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921958767_921958773 12 Left 921958767 1:221012273-221012295 CCAGGCTCCATTTTATCCTGCAG No data
Right 921958773 1:221012308-221012330 GCAGTTTCCTTAACAGCTTAAGG No data
921958767_921958770 -10 Left 921958767 1:221012273-221012295 CCAGGCTCCATTTTATCCTGCAG No data
Right 921958770 1:221012286-221012308 TATCCTGCAGACGGCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921958767 Original CRISPR CTGCAGGATAAAATGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr