ID: 921959803

View in Genome Browser
Species Human (GRCh38)
Location 1:221022710-221022732
Sequence CTGGCATCCTAGGGTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921959803_921959809 30 Left 921959803 1:221022710-221022732 CCTGTTTTACCCTAGGATGCCAG No data
Right 921959809 1:221022763-221022785 GCATTCAAATATGTATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921959803 Original CRISPR CTGGCATCCTAGGGTAAAAC AGG (reversed) Intergenic
No off target data available for this crispr