ID: 921960334

View in Genome Browser
Species Human (GRCh38)
Location 1:221027424-221027446
Sequence GAGAACACAAAATTTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921960332_921960334 7 Left 921960332 1:221027394-221027416 CCTGTCTGGTTGCTTTATTGAGT No data
Right 921960334 1:221027424-221027446 GAGAACACAAAATTTCCCATGGG No data
921960331_921960334 8 Left 921960331 1:221027393-221027415 CCCTGTCTGGTTGCTTTATTGAG No data
Right 921960334 1:221027424-221027446 GAGAACACAAAATTTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921960334 Original CRISPR GAGAACACAAAATTTCCCAT GGG Intergenic
No off target data available for this crispr