ID: 921962153

View in Genome Browser
Species Human (GRCh38)
Location 1:221047279-221047301
Sequence GAGGGTGAACAGAAGTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921962141_921962153 24 Left 921962141 1:221047232-221047254 CCCAGCTCATCTCACTGGGACTG 0: 53
1: 268
2: 806
3: 1033
4: 1193
Right 921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG No data
921962142_921962153 23 Left 921962142 1:221047233-221047255 CCAGCTCATCTCACTGGGACTGG 0: 72
1: 283
2: 411
3: 326
4: 353
Right 921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921962153 Original CRISPR GAGGGTGAACAGAAGTAGGG TGG Intergenic
No off target data available for this crispr