ID: 921965636

View in Genome Browser
Species Human (GRCh38)
Location 1:221085688-221085710
Sequence CTTTACATGAAAAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921965634_921965636 17 Left 921965634 1:221085648-221085670 CCTAAGGCATTACTGCAAAGAAG No data
Right 921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921965636 Original CRISPR CTTTACATGAAAAATGAGGA TGG Intergenic
No off target data available for this crispr