ID: 921965636 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:221085688-221085710 |
| Sequence | CTTTACATGAAAAATGAGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921965634_921965636 | 17 | Left | 921965634 | 1:221085648-221085670 | CCTAAGGCATTACTGCAAAGAAG | No data | ||
| Right | 921965636 | 1:221085688-221085710 | CTTTACATGAAAAATGAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921965636 | Original CRISPR | CTTTACATGAAAAATGAGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||