ID: 921966772

View in Genome Browser
Species Human (GRCh38)
Location 1:221098792-221098814
Sequence ATCTGCCATAGGCAAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921966769_921966772 8 Left 921966769 1:221098761-221098783 CCATGCTCAGTGCAGCAGACATT No data
Right 921966772 1:221098792-221098814 ATCTGCCATAGGCAAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921966772 Original CRISPR ATCTGCCATAGGCAAGGCAC TGG Intergenic
No off target data available for this crispr