ID: 921972556

View in Genome Browser
Species Human (GRCh38)
Location 1:221166119-221166141
Sequence CCGAGTCCTAGCCATGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921972556_921972565 26 Left 921972556 1:221166119-221166141 CCCAGATCATGGCTAGGACTCGG No data
Right 921972565 1:221166168-221166190 GTTATATAGCATTTGCCTCTGGG No data
921972556_921972560 -4 Left 921972556 1:221166119-221166141 CCCAGATCATGGCTAGGACTCGG No data
Right 921972560 1:221166138-221166160 TCGGGCCGAAGTGTTCTGTTTGG No data
921972556_921972561 -3 Left 921972556 1:221166119-221166141 CCCAGATCATGGCTAGGACTCGG No data
Right 921972561 1:221166139-221166161 CGGGCCGAAGTGTTCTGTTTGGG No data
921972556_921972564 25 Left 921972556 1:221166119-221166141 CCCAGATCATGGCTAGGACTCGG No data
Right 921972564 1:221166167-221166189 TGTTATATAGCATTTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921972556 Original CRISPR CCGAGTCCTAGCCATGATCT GGG (reversed) Intergenic
No off target data available for this crispr