ID: 921977885

View in Genome Browser
Species Human (GRCh38)
Location 1:221222221-221222243
Sequence GTGGGGAAGCAGAATGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921977877_921977885 21 Left 921977877 1:221222177-221222199 CCACTGCAACTGCAGAGTGAGCA No data
Right 921977885 1:221222221-221222243 GTGGGGAAGCAGAATGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921977885 Original CRISPR GTGGGGAAGCAGAATGTGTA GGG Intergenic
No off target data available for this crispr