ID: 921980732

View in Genome Browser
Species Human (GRCh38)
Location 1:221255740-221255762
Sequence ACGTGAAAGCAGAACTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921980732_921980737 4 Left 921980732 1:221255740-221255762 CCCTCAAAGTTCTGCTTTCACGT No data
Right 921980737 1:221255767-221255789 TACATTTATTGTAGGGGATTTGG No data
921980732_921980734 -4 Left 921980732 1:221255740-221255762 CCCTCAAAGTTCTGCTTTCACGT No data
Right 921980734 1:221255759-221255781 ACGTAATTTACATTTATTGTAGG No data
921980732_921980738 7 Left 921980732 1:221255740-221255762 CCCTCAAAGTTCTGCTTTCACGT No data
Right 921980738 1:221255770-221255792 ATTTATTGTAGGGGATTTGGAGG No data
921980732_921980736 -2 Left 921980732 1:221255740-221255762 CCCTCAAAGTTCTGCTTTCACGT No data
Right 921980736 1:221255761-221255783 GTAATTTACATTTATTGTAGGGG No data
921980732_921980735 -3 Left 921980732 1:221255740-221255762 CCCTCAAAGTTCTGCTTTCACGT No data
Right 921980735 1:221255760-221255782 CGTAATTTACATTTATTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921980732 Original CRISPR ACGTGAAAGCAGAACTTTGA GGG (reversed) Intergenic
No off target data available for this crispr