ID: 921985792

View in Genome Browser
Species Human (GRCh38)
Location 1:221310414-221310436
Sequence TGGGAATTTGCCACCTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921985792_921985796 19 Left 921985792 1:221310414-221310436 CCAACAAAGGTGGCAAATTCCCA No data
Right 921985796 1:221310456-221310478 CTGTTAATGAGGCAAAAACTAGG No data
921985792_921985797 26 Left 921985792 1:221310414-221310436 CCAACAAAGGTGGCAAATTCCCA No data
Right 921985797 1:221310463-221310485 TGAGGCAAAAACTAGGAAAGAGG No data
921985792_921985795 8 Left 921985792 1:221310414-221310436 CCAACAAAGGTGGCAAATTCCCA No data
Right 921985795 1:221310445-221310467 ATCAAATGAATCTGTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921985792 Original CRISPR TGGGAATTTGCCACCTTTGT TGG (reversed) Intergenic
No off target data available for this crispr