ID: 921986715

View in Genome Browser
Species Human (GRCh38)
Location 1:221320123-221320145
Sequence GAAATCTATCCCTTGAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921986715_921986720 1 Left 921986715 1:221320123-221320145 CCCCCACTCAAGGGATAGATTTC No data
Right 921986720 1:221320147-221320169 CCCACAGCCAAAGTTCTCAGAGG No data
921986715_921986723 18 Left 921986715 1:221320123-221320145 CCCCCACTCAAGGGATAGATTTC No data
Right 921986723 1:221320164-221320186 CAGAGGATCATGACTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921986715 Original CRISPR GAAATCTATCCCTTGAGTGG GGG (reversed) Intergenic
No off target data available for this crispr