ID: 921991634

View in Genome Browser
Species Human (GRCh38)
Location 1:221373043-221373065
Sequence GTGGCTCTGCTCACTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921991634_921991639 21 Left 921991634 1:221373043-221373065 CCCATATCAGTGAGCAGAGCCAC No data
Right 921991639 1:221373087-221373109 GGACAACCACATTTCAGAGATGG No data
921991634_921991637 0 Left 921991634 1:221373043-221373065 CCCATATCAGTGAGCAGAGCCAC No data
Right 921991637 1:221373066-221373088 ACCAGAAACATATCTTTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921991634 Original CRISPR GTGGCTCTGCTCACTGATAT GGG (reversed) Intergenic
No off target data available for this crispr